ID: 1038398993

View in Genome Browser
Species Human (GRCh38)
Location 8:27268836-27268858
Sequence ATGCAGATGCAGAATAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038398993_1038399002 21 Left 1038398993 8:27268836-27268858 CCCACCTTATTCTGCATCTGCAT No data
Right 1038399002 8:27268880-27268902 CCCTCTCTGCTTCCAAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038398993 Original CRISPR ATGCAGATGCAGAATAAGGT GGG (reversed) Intergenic
No off target data available for this crispr