ID: 1038399002

View in Genome Browser
Species Human (GRCh38)
Location 8:27268880-27268902
Sequence CCCTCTCTGCTTCCAAGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038398996_1038399002 -4 Left 1038398996 8:27268861-27268883 CCCATCTCCAAGACAGACCCCCT No data
Right 1038399002 8:27268880-27268902 CCCTCTCTGCTTCCAAGCAGTGG No data
1038398997_1038399002 -5 Left 1038398997 8:27268862-27268884 CCATCTCCAAGACAGACCCCCTC No data
Right 1038399002 8:27268880-27268902 CCCTCTCTGCTTCCAAGCAGTGG No data
1038398995_1038399002 17 Left 1038398995 8:27268840-27268862 CCTTATTCTGCATCTGCATCTCC No data
Right 1038399002 8:27268880-27268902 CCCTCTCTGCTTCCAAGCAGTGG No data
1038398991_1038399002 23 Left 1038398991 8:27268834-27268856 CCCCCACCTTATTCTGCATCTGC No data
Right 1038399002 8:27268880-27268902 CCCTCTCTGCTTCCAAGCAGTGG No data
1038398993_1038399002 21 Left 1038398993 8:27268836-27268858 CCCACCTTATTCTGCATCTGCAT No data
Right 1038399002 8:27268880-27268902 CCCTCTCTGCTTCCAAGCAGTGG No data
1038398992_1038399002 22 Left 1038398992 8:27268835-27268857 CCCCACCTTATTCTGCATCTGCA No data
Right 1038399002 8:27268880-27268902 CCCTCTCTGCTTCCAAGCAGTGG No data
1038398994_1038399002 20 Left 1038398994 8:27268837-27268859 CCACCTTATTCTGCATCTGCATC No data
Right 1038399002 8:27268880-27268902 CCCTCTCTGCTTCCAAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038399002 Original CRISPR CCCTCTCTGCTTCCAAGCAG TGG Intergenic
No off target data available for this crispr