ID: 1038400003

View in Genome Browser
Species Human (GRCh38)
Location 8:27277387-27277409
Sequence GAGGGGAAAAAGAAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038400003_1038400006 -9 Left 1038400003 8:27277387-27277409 CCCTCCTCTTTCTTTTTCCCCTC No data
Right 1038400006 8:27277401-27277423 TTTCCCCTCTCCCTGTCTTCTGG No data
1038400003_1038400007 -8 Left 1038400003 8:27277387-27277409 CCCTCCTCTTTCTTTTTCCCCTC No data
Right 1038400007 8:27277402-27277424 TTCCCCTCTCCCTGTCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038400003 Original CRISPR GAGGGGAAAAAGAAAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr