ID: 1038400355

View in Genome Browser
Species Human (GRCh38)
Location 8:27279816-27279838
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038400350_1038400355 30 Left 1038400350 8:27279763-27279785 CCAGTAGGCTGGTCATCCATCAC No data
Right 1038400355 8:27279816-27279838 GCTTCTGTCTTCCCTGGTACTGG No data
1038400352_1038400355 14 Left 1038400352 8:27279779-27279801 CCATCACTTTTTGTTGGTCATCG No data
Right 1038400355 8:27279816-27279838 GCTTCTGTCTTCCCTGGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038400355 Original CRISPR GCTTCTGTCTTCCCTGGTAC TGG Intergenic