ID: 1038401136

View in Genome Browser
Species Human (GRCh38)
Location 8:27285791-27285813
Sequence GGGTGGGATAAATACTTTAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038401136 Original CRISPR GGGTGGGATAAATACTTTAC AGG Exonic
901253332 1:7798440-7798462 GGCTGGGAGAAATATTTTATTGG - Intronic
905113959 1:35621097-35621119 GGCAGGGATAAATACTTCTCTGG - Intronic
907251406 1:53142138-53142160 GGGTGTGATAAACACTTTGCAGG - Intronic
913574295 1:120154917-120154939 GAATGGGATAAATACTGTATGGG - Exonic
914295566 1:146319720-146319742 GAATGGGATAAATACTGTATGGG - Intergenic
914556605 1:148770501-148770523 GAATGGGATAAATACTGTATGGG - Intergenic
914616229 1:149359729-149359751 GAATGGGATAAATACTGTATGGG + Intergenic
915347017 1:155202723-155202745 GGGTGGGATAAATGCTGGTCCGG - Intronic
916591708 1:166197357-166197379 GAGTGGGATAAACACTGGACTGG + Intergenic
919724023 1:200870449-200870471 GTGTGGGAGAAATTCTTGACAGG + Intergenic
922781826 1:228258568-228258590 GAGTGCGATAAATTCTTTAATGG + Intronic
1071407462 10:85351824-85351846 GGGTGGGATATATACTGTTATGG + Intergenic
1071838242 10:89441338-89441360 GGGTGGGCTCAATGCTTTAAAGG - Intronic
1072355628 10:94607169-94607191 GGGAGTGGTAATTACTTTACAGG + Intronic
1074316741 10:112368194-112368216 GGGTGTGACAACTACTTGACTGG - Intergenic
1077772973 11:5241271-5241293 TAGTGTGATAAAGACTTTACAGG + Intergenic
1079866450 11:25741302-25741324 GGGTGGTATAAACATTTTAGTGG + Intergenic
1083702558 11:64489436-64489458 GAGTGGAATGAATAATTTACAGG - Intergenic
1089777534 11:120848759-120848781 GGGTGGGATAAAGACCTAATTGG - Intronic
1090886027 11:130877677-130877699 GGGTGGTATAAATGCCTTTCAGG + Exonic
1092578755 12:9817275-9817297 GTGTGAGCTAAATCCTTTACTGG - Intergenic
1099304195 12:80935244-80935266 GAGTGTGATAAATGCTTTAATGG + Intronic
1106782963 13:33078273-33078295 GGGCTGGATAAATAATTTGCAGG - Intergenic
1110068973 13:71148803-71148825 TCGTGGGGAAAATACTTTACAGG - Intergenic
1118095346 14:62531113-62531135 GGGTGGGATAACTTCTATAGTGG + Intergenic
1118096632 14:62545136-62545158 GGCTGGAAGAAAGACTTTACTGG - Intergenic
1121004688 14:90482507-90482529 GGGTGGGAGAAAGACTTACCAGG - Intergenic
1126176272 15:45738639-45738661 TGGAGGGAAAACTACTTTACAGG + Intergenic
1128446363 15:67764843-67764865 GGCTGGCATAAATACTCAACTGG - Intronic
1151243888 17:72779517-72779539 GTGTAGGATAAATCCTTTCCTGG + Intronic
1153702279 18:7707740-7707762 GAGTGGGATTAATACTTGATGGG + Intronic
1161860716 19:6796260-6796282 AGGTGGGAGAAATACTTCAAAGG + Intronic
929263579 2:39893915-39893937 GGGTGGGAGAAATATTGTTCTGG + Intergenic
930053381 2:47234238-47234260 GGGTGGAATTAATTCTTAACTGG - Intergenic
930159099 2:48135186-48135208 GGTAGGGATTAATACCTTACAGG - Intergenic
939558686 2:143708413-143708435 AGATGGGATAAAGACTTTTCTGG - Intronic
943162674 2:184275428-184275450 GGGTGGGAAAATATCTTTACAGG - Intergenic
944143491 2:196481989-196482011 GGGTGGGATACATAATTTGCAGG + Intronic
944273352 2:197806476-197806498 TGTTGGGAAAAAGACTTTACTGG - Intronic
1172003133 20:31796722-31796744 AGGTGGGAAGAATACTTTATAGG + Intronic
1175422761 20:58845638-58845660 GGGGGGCATAAATTTTTTACTGG + Intronic
1181182696 22:21078765-21078787 GGGTGGGTGGAATTCTTTACAGG + Intergenic
1184786900 22:46676389-46676411 GGGTGGGACAGACCCTTTACAGG + Intronic
1184927526 22:47653755-47653777 GAGTTTGATAAATACTTTAGTGG + Intergenic
952018226 3:28985102-28985124 GTGTGGGATAAATGCTTTATAGG + Intergenic
952145949 3:30532263-30532285 GGGTTGGAAAAAGACTTTAATGG - Intergenic
955758066 3:62246754-62246776 GGGTAGAATAAATACTTCATAGG - Intronic
964592065 3:158376123-158376145 GGGAGGGATATATTCTTTCCAGG - Intronic
964634941 3:158848172-158848194 GGGAGGGATTAATACTTCAAAGG - Intergenic
966529962 3:180965924-180965946 GGGTTAGATAAATACTACACTGG + Intronic
967167393 3:186794180-186794202 TGGTGGGAGAAAAACTTTAATGG - Intronic
967199543 3:187059993-187060015 GGGTGGGATAAGAGCTTTTCAGG + Intronic
973656695 4:53055533-53055555 TGCTGGGATGAATACCTTACAGG - Intronic
976947106 4:90783672-90783694 TGGTGAGATAAATATTTGACTGG - Intronic
977844879 4:101756976-101756998 GGGTGGCATGAATACTTTAATGG + Intronic
980039043 4:127917442-127917464 GAGTGGGACAAGTACTTTTCAGG - Intergenic
980425703 4:132625203-132625225 GGGTGGGAAAAAAACTATAATGG - Intergenic
980532608 4:134073934-134073956 GGGAGGGATAAATGCTTTTGTGG - Intergenic
982065061 4:151647227-151647249 GGCTGCCATAAATACTTTACAGG + Intronic
983411155 4:167399790-167399812 CAGTGGGATAAATAGTTTAGAGG - Intergenic
990036658 5:51329728-51329750 GGGTAGTATAAATAGTTTATAGG + Intergenic
990158687 5:52909952-52909974 GTGTGGGAGACATACTTTAATGG - Intronic
991524695 5:67543516-67543538 GGGTGGATTAATTGCTTTACTGG - Intergenic
993422426 5:87719019-87719041 AGGTGGGAAATATACTTTAAGGG - Intergenic
998869360 5:146537080-146537102 GGGTGGGAAAAAGACTTCAATGG + Intergenic
1004252111 6:14031477-14031499 GGGAGGGAGAAATTCTTTCCAGG - Intergenic
1011512125 6:88113110-88113132 GAGTGGAATAAATACTTAAACGG + Intergenic
1016366519 6:143324402-143324424 CAGTGGGAAAAAAACTTTACAGG + Intronic
1027399525 7:77793134-77793156 GGTTGGGACAAATAATTTAGAGG - Intergenic
1032172613 7:129597944-129597966 AGGAGGGATAATTACTTTATTGG - Intergenic
1035658576 8:1330288-1330310 GGGTGGGAGCACTACTTCACAGG + Intergenic
1035837521 8:2770575-2770597 GGCTGTGAGAAATACTTTTCTGG - Intergenic
1038388031 8:27167931-27167953 GGGTGGGAGAAATGCTTGAAAGG + Intergenic
1038401136 8:27285791-27285813 GGGTGGGATAAATACTTTACAGG + Exonic
1039335803 8:36587907-36587929 GGGTGAAATAAACACTTTTCAGG - Intergenic
1039664651 8:39511719-39511741 GGGTGTAATAAATATCTTACAGG + Intergenic
1040601891 8:48893041-48893063 GGATTGGATAAAAACTTTATGGG - Intergenic
1043030706 8:75130661-75130683 GGGTGGGAAAAATAGTTTCGTGG + Intergenic
1044958710 8:97508156-97508178 GGATGGAGTAAATAGTTTACTGG - Intergenic
1047917927 8:129603098-129603120 AGGAGGGAAAAATAGTTTACTGG - Intergenic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1058715703 9:107720319-107720341 GGGTAGTAGAAAGACTTTACAGG - Intergenic
1187416587 X:19098437-19098459 GGGTGGGCTGAATTTTTTACTGG + Intronic
1199004239 X:142676042-142676064 GGGTAGGAAAAATATTTTAATGG - Intergenic
1199449702 X:147965718-147965740 GAGAAGGATAAATACTTTAGTGG + Intergenic
1199545526 X:149004295-149004317 GGGTGGGATAAATAGGTAACTGG - Intergenic