ID: 1038401815

View in Genome Browser
Species Human (GRCh38)
Location 8:27289429-27289451
Sequence CTACGATGGGAGATGGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 131}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038401803_1038401815 20 Left 1038401803 8:27289386-27289408 CCAAGTTTCCTGGCCACCTTCTC 0: 1
1: 0
2: 2
3: 34
4: 309
Right 1038401815 8:27289429-27289451 CTACGATGGGAGATGGGCCAAGG 0: 1
1: 0
2: 1
3: 7
4: 131
1038401801_1038401815 28 Left 1038401801 8:27289378-27289400 CCTCAGGCCCAAGTTTCCTGGCC 0: 1
1: 0
2: 1
3: 33
4: 340
Right 1038401815 8:27289429-27289451 CTACGATGGGAGATGGGCCAAGG 0: 1
1: 0
2: 1
3: 7
4: 131
1038401800_1038401815 29 Left 1038401800 8:27289377-27289399 CCCTCAGGCCCAAGTTTCCTGGC 0: 1
1: 0
2: 0
3: 21
4: 256
Right 1038401815 8:27289429-27289451 CTACGATGGGAGATGGGCCAAGG 0: 1
1: 0
2: 1
3: 7
4: 131
1038401807_1038401815 4 Left 1038401807 8:27289402-27289424 CCTTCTCCAAGACAAGACTGGAC 0: 1
1: 0
2: 2
3: 14
4: 166
Right 1038401815 8:27289429-27289451 CTACGATGGGAGATGGGCCAAGG 0: 1
1: 0
2: 1
3: 7
4: 131
1038401802_1038401815 21 Left 1038401802 8:27289385-27289407 CCCAAGTTTCCTGGCCACCTTCT 0: 1
1: 0
2: 1
3: 21
4: 239
Right 1038401815 8:27289429-27289451 CTACGATGGGAGATGGGCCAAGG 0: 1
1: 0
2: 1
3: 7
4: 131
1038401805_1038401815 7 Left 1038401805 8:27289399-27289421 CCACCTTCTCCAAGACAAGACTG 0: 1
1: 0
2: 0
3: 16
4: 218
Right 1038401815 8:27289429-27289451 CTACGATGGGAGATGGGCCAAGG 0: 1
1: 0
2: 1
3: 7
4: 131
1038401810_1038401815 -2 Left 1038401810 8:27289408-27289430 CCAAGACAAGACTGGACTGGGCT 0: 1
1: 0
2: 2
3: 14
4: 188
Right 1038401815 8:27289429-27289451 CTACGATGGGAGATGGGCCAAGG 0: 1
1: 0
2: 1
3: 7
4: 131
1038401804_1038401815 12 Left 1038401804 8:27289394-27289416 CCTGGCCACCTTCTCCAAGACAA 0: 1
1: 0
2: 4
3: 23
4: 236
Right 1038401815 8:27289429-27289451 CTACGATGGGAGATGGGCCAAGG 0: 1
1: 0
2: 1
3: 7
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038401815 Original CRISPR CTACGATGGGAGATGGGCCA AGG Intronic
900001399 1:16819-16841 CTGGGATGGGAGCTGGGCCGGGG - Intergenic
900021119 1:187341-187363 CTGGGATGGGAGCTGGGCCGGGG - Intergenic
901000438 1:6146447-6146469 CACAGAAGGGAGATGGGCCATGG + Intronic
901317625 1:8319305-8319327 CTAGGAAGGGAGGTGGCCCAAGG + Intronic
911957096 1:104251070-104251092 GGACGATGGGCCATGGGCCATGG + Intergenic
915848942 1:159300223-159300245 CTTAGATGGGAGATGGAGCAGGG - Intronic
917779506 1:178377507-178377529 ATAATATAGGAGATGGGCCAAGG + Intronic
917981508 1:180272338-180272360 CAAAGATGGGAGAGGGGCTAGGG - Intronic
918363769 1:183785221-183785243 GTGCAATGGGAGATGGGCTAAGG - Intronic
919365103 1:196650181-196650203 CTCCGAGGGGAGTTTGGCCAGGG + Intergenic
919784916 1:201252900-201252922 CTATGTTGGGAGGTGGGTCAGGG + Intergenic
920128525 1:203712882-203712904 CTTTAATGGGAGGTGGGCCAGGG - Intronic
920431621 1:205922517-205922539 CTAAGATAGGACATGGCCCATGG - Intronic
922703158 1:227774094-227774116 ACAGGCTGGGAGATGGGCCACGG - Intronic
1066627913 10:37428134-37428156 CTACTATGGGTTATGTGCCAGGG + Intergenic
1066704884 10:38166561-38166583 CTAGGATGGGAGATGAGCTGAGG - Intergenic
1070673706 10:78397352-78397374 CCACGAAGTCAGATGGGCCATGG + Intergenic
1070978707 10:80627397-80627419 CTAAGCTGGGAGCTGGGCAATGG - Intronic
1071802179 10:89076022-89076044 CAACAATGGGACATAGGCCATGG + Intergenic
1075475525 10:122730492-122730514 CGACTATGGGTGATGGGGCAAGG + Intergenic
1076602564 10:131668289-131668311 CTAGGAACAGAGATGGGCCAGGG + Intergenic
1076841239 10:133046708-133046730 CTCAGCTGGGAGATGGGACAGGG - Intergenic
1077482928 11:2824991-2825013 GTACGATGGGGCCTGGGCCAGGG + Intronic
1077516412 11:3004540-3004562 ACACCATGGGAGGTGGGCCATGG - Intronic
1078642292 11:13108031-13108053 CTAAGAGAAGAGATGGGCCAAGG - Intergenic
1083310012 11:61779240-61779262 CTGCCATGGGCCATGGGCCATGG - Intronic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1088960494 11:114658912-114658934 CTACCATGGAAGAAGGGACAAGG + Intergenic
1089646553 11:119884215-119884237 CCACGATGGGGGCTGGGTCAGGG - Intergenic
1095933794 12:47655229-47655251 CTCCCATGGGAGAAGGGACAAGG + Intergenic
1095946007 12:47753758-47753780 CTCCAATGGGAGTTGGGGCAGGG - Intronic
1096567903 12:52496518-52496540 CCACCATGGGACATGAGCCATGG - Intergenic
1102573360 12:113840974-113840996 GTGCCACGGGAGATGGGCCAAGG - Intronic
1103988529 12:124783081-124783103 CAAGGTGGGGAGATGGGCCATGG + Intronic
1112266585 13:97929687-97929709 ATATCATGGGAGAGGGGCCAGGG + Intergenic
1117772916 14:59152426-59152448 CTAGAAAGGGAGATGGGCCTGGG - Intergenic
1118022825 14:61736474-61736496 CTACTAGGGGAGAGGGGCAAGGG - Intronic
1119383999 14:74245877-74245899 CTAGGATGTGAGCTGGGGCATGG + Intronic
1121319267 14:92981539-92981561 CTCCCATGGGAGATAGGCCTGGG - Intronic
1122205847 14:100147622-100147644 CTGTGATGGGAGCTGGGCCAAGG - Intronic
1122897964 14:104769753-104769775 CAGGGATGGGGGATGGGCCAGGG - Exonic
1126536311 15:49769338-49769360 ATACGATGGGAGATGGGTGTGGG - Intergenic
1128523593 15:68391555-68391577 CCAACAGGGGAGATGGGCCATGG + Intronic
1130444513 15:83987846-83987868 CTATGAAGTGAGATGGGGCAGGG + Intronic
1131369343 15:91866874-91866896 CCAGGGTGGGAGATGGGCCTGGG + Intronic
1132375812 15:101327463-101327485 CTACGCTGGGAAACGGCCCAGGG + Intronic
1132452109 15:101974119-101974141 CTGGGATGGGAGCTGGGCCGGGG + Intergenic
1132454784 16:16502-16524 CTGGGATGGGAGCTGGGCCGGGG - Intronic
1132468756 16:90088-90110 CTGGGAAGGGAGAGGGGCCAGGG + Intronic
1132495617 16:261922-261944 CTACAATGGGAGATGTGGAAGGG - Intronic
1133805702 16:9124644-9124666 CTACGAGGGAAGCTGGACCAAGG + Intergenic
1134821542 16:17251318-17251340 CTCCAATGGGTGATGGGCAAAGG - Intronic
1140418379 16:74794534-74794556 CTACAATGGGAAATGGAACAGGG - Intergenic
1141569565 16:84926003-84926025 ATTCGATGGGAGCTGGGTCATGG - Intergenic
1142399518 16:89852034-89852056 GGAGGATGGAAGATGGGCCAGGG - Intronic
1142399533 16:89852073-89852095 GGAGGATGGAAGATGGGCCAGGG - Intronic
1142399549 16:89852112-89852134 GGAGGATGGAAGATGGGCCATGG - Intronic
1142399566 16:89852151-89852173 AGAGGATGGAAGATGGGCCATGG - Intronic
1142399579 16:89852190-89852212 GGAGGATGGAAGATGGGCCATGG - Intronic
1142399596 16:89852229-89852251 GGAGGATGGAAGATGGGCCATGG - Intronic
1142399611 16:89852268-89852290 AGAGGATGGAAGATGGGCCATGG - Intronic
1142399624 16:89852307-89852329 GGAGGATGGAAGATGGGCCATGG - Intronic
1142399640 16:89852346-89852368 GGAGGATGGAAGATGGGCCATGG - Intronic
1142399657 16:89852385-89852407 GGAGGATGGAAGATGGGCCATGG - Intronic
1142399674 16:89852424-89852446 AGAGGATGGAAGATGGGCCATGG - Intronic
1142399687 16:89852463-89852485 GGAGGATGGAAGATGGGCCATGG - Intronic
1142399704 16:89852502-89852524 GGAGGATGGAAGATGGGCCATGG - Intronic
1142399736 16:89852580-89852602 GGAGGATGGAAGATGGGCCAGGG - Intronic
1152219318 17:79053272-79053294 TTACGATGGCACAGGGGCCAAGG + Intergenic
1156049539 18:32915604-32915626 CTAGGATGAGAGCAGGGCCATGG + Intergenic
1158172177 18:54612567-54612589 CGAGGATGGGAGCTGGGTCAAGG - Intergenic
1160503967 18:79417113-79417135 CTATGGTGGGAGATGGGCTGTGG + Intronic
1161298743 19:3532755-3532777 CTCTGAAGGGAGATGGGCGAGGG + Intronic
1164586081 19:29476857-29476879 CTAGCATGGGAGCTGGGCTAAGG - Intergenic
1165062520 19:33211736-33211758 GTAGGATGGGAGATGGGGGAGGG + Intronic
1165317752 19:35066912-35066934 GTACAATGGGAGCTGGGCCTGGG - Intergenic
1166915951 19:46196288-46196310 CTGAGATGGGAGATGGGCTCGGG - Intergenic
1166925090 19:46261501-46261523 CTGAGATGGGAGATGGGCTCGGG + Intergenic
928856927 2:35813711-35813733 GTCAAATGGGAGATGGGCCATGG - Intergenic
935351340 2:102154101-102154123 ATACAATGGGAGATAGTCCAGGG - Intronic
936568326 2:113596595-113596617 CTGGGATGGGAGCTGGGCCGGGG + Intergenic
937311544 2:120906094-120906116 CTACTTGGGGAGCTGGGCCAGGG + Intronic
938577544 2:132618852-132618874 AGAAGATGGGAGAGGGGCCAAGG + Intronic
939982606 2:148799113-148799135 CTACTTTGGGAGATGGGAGATGG - Intergenic
941233225 2:162938202-162938224 CTCCGAGGGGAGTTTGGCCAGGG + Intergenic
948126365 2:235567379-235567401 CTCAGCTGGGAGATGGGCCCTGG + Intronic
948357851 2:237394482-237394504 CTAGGATGGCGGGTGGGCCAGGG - Intronic
1170611165 20:17914886-17914908 CTACAAAGAGAGAGGGGCCAGGG + Intergenic
1170959854 20:21015767-21015789 CTAGGATGGGAGATGGATCCAGG + Intergenic
1171433870 20:25104372-25104394 CTCTCATGGGACATGGGCCAAGG + Intergenic
1174251314 20:49221547-49221569 GTACGATGGCAGCTGGGCCCTGG + Exonic
1175427759 20:58880182-58880204 CTACAAAGGGAGATGTGCCAAGG - Intronic
1176024321 20:62978094-62978116 CCAGGAGGGGAGATGGCCCACGG - Intergenic
1178526601 21:33334910-33334932 CTGCAGTGGGAGATGGGGCAGGG + Intronic
1180845452 22:18978795-18978817 CTAGGAAGGGTGAGGGGCCAGGG - Intergenic
1182403692 22:30105317-30105339 CTGCGATGGCAGCTGGGCCTGGG + Intronic
1184670442 22:46009665-46009687 CTTCAATGGGAGAAGGACCAAGG - Intergenic
949865850 3:8546582-8546604 CTACTATGGTAGAAGGGACATGG + Intronic
953753911 3:45630595-45630617 GTAGAATGGGAGGTGGGCCAGGG + Intronic
955518175 3:59748638-59748660 GTACAAGGGGAGATGGGACAGGG + Intergenic
958126463 3:89362631-89362653 GGACGTTGGGAGATGGGGCAAGG + Intronic
962906194 3:139805256-139805278 TTATGGTGGGAGATGGGGCATGG - Intergenic
968041247 3:195591114-195591136 CTCAGCTGGGAGATGGGCCAGGG + Intergenic
976933365 4:90597800-90597822 CTACCATGGCAGGTGGGGCAGGG - Intronic
977644955 4:99401986-99402008 CTAAGATGTGAGATGGGACTAGG + Intergenic
983931085 4:173454120-173454142 CTAGGAAGGCAGCTGGGCCAGGG + Intergenic
985778540 5:1857751-1857773 CTACGAGGGGAGGCGGGGCAGGG + Intergenic
986281166 5:6323675-6323697 TTTGGATGGGAAATGGGCCAAGG + Intergenic
987097287 5:14561102-14561124 CTAAGAGGGGAGATGGGCACAGG + Intergenic
998404378 5:141865676-141865698 CAACTATTGGAGATGGGACAGGG + Intronic
1005380477 6:25229270-25229292 CTCCAATGGGAGAAGGGACAAGG - Intergenic
1006309667 6:33248968-33248990 CGAGGACGGGAGAAGGGCCAAGG - Intergenic
1007024948 6:38561779-38561801 CTACGGTGGGGGATGGGGCAAGG + Intronic
1012431007 6:99163499-99163521 GAACGATGGGGGATGGGGCAAGG - Intergenic
1015756220 6:136609349-136609371 CTGAGGTGGGAGCTGGGCCAGGG + Intronic
1019292808 7:258566-258588 CTGGGCTGGGAGCTGGGCCATGG - Intronic
1019546718 7:1581103-1581125 TTAGGATGGGAGGTGGCCCAGGG + Intergenic
1019910828 7:4099766-4099788 ATGTGATGGGAGATGGCCCAAGG + Intronic
1023058417 7:36308003-36308025 CTAGAATAGGAGCTGGGCCAGGG + Intergenic
1024491150 7:49986853-49986875 TTAGGATGGGATATGGGCCCAGG + Intronic
1025951138 7:66146303-66146325 CTACGATGGGATAAGGGGCCCGG + Intronic
1025982941 7:66422267-66422289 CTTTCATGGCAGATGGGCCAAGG - Intergenic
1026610748 7:71857742-71857764 CTTCCATGGGAGAGGGCCCAAGG + Intronic
1032875528 7:136034272-136034294 CTAAGATGAGAGGTGGACCAAGG - Intergenic
1036282885 8:7416754-7416776 CTTCCAGGTGAGATGGGCCAGGG - Exonic
1036338584 8:7894764-7894786 CTTCCAGGTGAGATGGGCCAGGG + Exonic
1038401815 8:27289429-27289451 CTACGATGGGAGATGGGCCAAGG + Intronic
1038414052 8:27380369-27380391 CTACCATGTGAGTTGTGCCAGGG + Intronic
1048805624 8:138238498-138238520 CCACGAGGGGAGAGGGGCCAGGG + Intronic
1049884204 9:16930-16952 CTGGGATGGGAGCTGGGCCGGGG - Intergenic
1055434902 9:76282767-76282789 CTACTATGGGAGATGGGCAATGG - Intronic
1060538795 9:124415293-124415315 CTCGGGTGGGAGCTGGGCCAAGG - Intronic
1190492887 X:51000747-51000769 CAAGGATGGTAGATGGGCAAAGG - Intergenic
1190511753 X:51179820-51179842 CAAGGATGGTAGATGGGCAAAGG + Intergenic
1191934568 X:66412451-66412473 CAATGATGGGAGATGTGGCATGG + Intergenic
1192236136 X:69297366-69297388 CTACGGGGGGAGGGGGGCCATGG - Intergenic
1195672005 X:107477723-107477745 CTGCGATGGTAGGTGGGCCTGGG + Intergenic
1197828114 X:130612503-130612525 ATACGATGGGAGATTGGGAAAGG + Intergenic
1198849028 X:140945349-140945371 CTATAATGGGAGATGAGCCAGGG + Intergenic
1200401599 X:156023226-156023248 CTGGGATGGGAGCTGGGCCGGGG + Intergenic