ID: 1038402887

View in Genome Browser
Species Human (GRCh38)
Location 8:27298783-27298805
Sequence TAGCCCAGCCTGGTACAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038402883_1038402887 -8 Left 1038402883 8:27298768-27298790 CCCTCAGACATCCTGTAGCCCAG 0: 1
1: 0
2: 2
3: 14
4: 157
Right 1038402887 8:27298783-27298805 TAGCCCAGCCTGGTACAGACTGG No data
1038402882_1038402887 7 Left 1038402882 8:27298753-27298775 CCATGGGATAAAGAGCCCTCAGA 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1038402887 8:27298783-27298805 TAGCCCAGCCTGGTACAGACTGG No data
1038402881_1038402887 21 Left 1038402881 8:27298739-27298761 CCTGAATCAGACATCCATGGGAT 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1038402887 8:27298783-27298805 TAGCCCAGCCTGGTACAGACTGG No data
1038402884_1038402887 -9 Left 1038402884 8:27298769-27298791 CCTCAGACATCCTGTAGCCCAGC 0: 1
1: 0
2: 0
3: 14
4: 217
Right 1038402887 8:27298783-27298805 TAGCCCAGCCTGGTACAGACTGG No data
1038402878_1038402887 27 Left 1038402878 8:27298733-27298755 CCTGATCCTGAATCAGACATCCA 0: 1
1: 1
2: 0
3: 10
4: 112
Right 1038402887 8:27298783-27298805 TAGCCCAGCCTGGTACAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038402887 Original CRISPR TAGCCCAGCCTGGTACAGAC TGG Intronic
No off target data available for this crispr