ID: 1038403584

View in Genome Browser
Species Human (GRCh38)
Location 8:27305358-27305380
Sequence ACTGCTGGAGGCCATCACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038403574_1038403584 26 Left 1038403574 8:27305309-27305331 CCCTTTGTGTTCAGACCTCCTTC 0: 1
1: 0
2: 0
3: 17
4: 248
Right 1038403584 8:27305358-27305380 ACTGCTGGAGGCCATCACTCAGG No data
1038403577_1038403584 8 Left 1038403577 8:27305327-27305349 CCTTCCAAAGCAAGTGTCTGCCA 0: 1
1: 0
2: 0
3: 19
4: 179
Right 1038403584 8:27305358-27305380 ACTGCTGGAGGCCATCACTCAGG No data
1038403576_1038403584 11 Left 1038403576 8:27305324-27305346 CCTCCTTCCAAAGCAAGTGTCTG 0: 1
1: 0
2: 1
3: 21
4: 191
Right 1038403584 8:27305358-27305380 ACTGCTGGAGGCCATCACTCAGG No data
1038403573_1038403584 27 Left 1038403573 8:27305308-27305330 CCCCTTTGTGTTCAGACCTCCTT 0: 1
1: 0
2: 0
3: 15
4: 279
Right 1038403584 8:27305358-27305380 ACTGCTGGAGGCCATCACTCAGG No data
1038403578_1038403584 4 Left 1038403578 8:27305331-27305353 CCAAAGCAAGTGTCTGCCATGCA 0: 1
1: 0
2: 0
3: 15
4: 178
Right 1038403584 8:27305358-27305380 ACTGCTGGAGGCCATCACTCAGG No data
1038403575_1038403584 25 Left 1038403575 8:27305310-27305332 CCTTTGTGTTCAGACCTCCTTCC 0: 1
1: 0
2: 0
3: 17
4: 274
Right 1038403584 8:27305358-27305380 ACTGCTGGAGGCCATCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038403584 Original CRISPR ACTGCTGGAGGCCATCACTC AGG Intronic
No off target data available for this crispr