ID: 1038410356

View in Genome Browser
Species Human (GRCh38)
Location 8:27353763-27353785
Sequence CACTTAGACCTGACTATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038410351_1038410356 0 Left 1038410351 8:27353740-27353762 CCAACTCCGTAAACCTTATCAGT 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1038410356 8:27353763-27353785 CACTTAGACCTGACTATGGGTGG No data
1038410350_1038410356 9 Left 1038410350 8:27353731-27353753 CCTGGAGTGCCAACTCCGTAAAC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1038410356 8:27353763-27353785 CACTTAGACCTGACTATGGGTGG No data
1038410352_1038410356 -6 Left 1038410352 8:27353746-27353768 CCGTAAACCTTATCAGTCACTTA 0: 1
1: 0
2: 1
3: 8
4: 167
Right 1038410356 8:27353763-27353785 CACTTAGACCTGACTATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038410356 Original CRISPR CACTTAGACCTGACTATGGG TGG Intronic
No off target data available for this crispr