ID: 1038410708

View in Genome Browser
Species Human (GRCh38)
Location 8:27356881-27356903
Sequence AAACTAGGGGTTGTGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038410700_1038410708 25 Left 1038410700 8:27356833-27356855 CCATTGACATCACATCCTTTAAG 0: 2
1: 0
2: 3
3: 10
4: 199
Right 1038410708 8:27356881-27356903 AAACTAGGGGTTGTGGAGATGGG No data
1038410701_1038410708 10 Left 1038410701 8:27356848-27356870 CCTTTAAGAGATGAAACTGTAGA 0: 1
1: 0
2: 0
3: 15
4: 218
Right 1038410708 8:27356881-27356903 AAACTAGGGGTTGTGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038410708 Original CRISPR AAACTAGGGGTTGTGGAGAT GGG Intronic
No off target data available for this crispr