ID: 1038410865

View in Genome Browser
Species Human (GRCh38)
Location 8:27358704-27358726
Sequence GAAAAGGCAAAGATGAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1243
Summary {0: 1, 1: 0, 2: 14, 3: 150, 4: 1078}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038410865 Original CRISPR GAAAAGGCAAAGATGAAGCA TGG (reversed) Intronic
900588277 1:3444500-3444522 GAAAAGGCAAAGCTACAGGATGG + Intergenic
901948416 1:12722034-12722056 GAAAACGAAGAGATGAAGCCGGG + Intronic
902137520 1:14322953-14322975 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
902927818 1:19708624-19708646 GAAATGACAAAGGTGAAGCTGGG - Intronic
903150640 1:21405560-21405582 AAAAAGGAAAAGAAAAAGCATGG - Intergenic
903342853 1:22665367-22665389 GAAAGGGCAAAGAAGCAGGAAGG + Intergenic
903364520 1:22797761-22797783 GAGAAGGGAAAGATGATGAAGGG - Intronic
903405361 1:23091129-23091151 GAAAAGGCAAAGAAGGAAAAGGG + Intronic
903691912 1:25180203-25180225 GAAAAGAGAAAGATGAAGATGGG + Intergenic
904251080 1:29224829-29224851 GGAAAAGCAAAGATGACACAAGG - Intronic
906083594 1:43110285-43110307 GGGAAGGCAAAGAGGAAGGAGGG + Intergenic
906443143 1:45868538-45868560 GCAAAGGCAAAAAGCAAGCAGGG - Intronic
906471568 1:46135014-46135036 CAAGAGGCAATGATGAATCAAGG + Intronic
906644864 1:47467246-47467268 GAAAAGGAAATCATGAAGGATGG - Intergenic
906720407 1:48000245-48000267 GAATAGGCAAATATATAGCAAGG + Intergenic
906846249 1:49196020-49196042 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
907328457 1:53656125-53656147 GAAGAGGAAAAGAGGAAGCACGG + Intronic
907398742 1:54210974-54210996 GAGGAGGCAAAGATGAGGCTGGG - Intronic
907432829 1:54423800-54423822 AAAAAGGCTAAGTTGAAGCAAGG - Intergenic
907586959 1:55627624-55627646 GAAGAGGGAAAGATGAAGGAAGG - Intergenic
907589182 1:55649803-55649825 GAAAAGGGAAAGAGGAAAGATGG + Intergenic
907687361 1:56624705-56624727 TGAAAGGCAAAGGGGAAGCAAGG - Intronic
908040971 1:60112612-60112634 GAAAAGGCAAAACTGAAGAGTGG - Intergenic
908123039 1:61003865-61003887 GAGAATGAAAAGATGAAGCGAGG - Intronic
908342201 1:63193117-63193139 CAAAAGGCAAAGCTGAAGCGAGG + Intergenic
908397869 1:63742814-63742836 TCAAAGGAGAAGATGAAGCAGGG + Intergenic
908792394 1:67795814-67795836 GAAAAGGGCAACATGAACCAAGG + Intronic
908829363 1:68164009-68164031 GAAAAGGAAGAGATGATCCATGG + Intronic
908948411 1:69527698-69527720 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
909304569 1:74056996-74057018 GCGAAGGCAAAGGGGAAGCAAGG - Intronic
909481188 1:76130269-76130291 GAATTGGCAAAGATGTAGCAAGG + Intronic
909573285 1:77142620-77142642 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
909823458 1:80095881-80095903 TACAAGGAAAAGAGGAAGCAAGG + Intergenic
909973678 1:82021094-82021116 GAGGAGGCAAAGGGGAAGCAAGG - Intergenic
910312335 1:85838413-85838435 GAAAAGACAAAGATGATTCTAGG + Intronic
910481257 1:87660735-87660757 GGTAATACAAAGATGAAGCAGGG + Intergenic
910553469 1:88502835-88502857 GAAACGCCAGATATGAAGCAAGG - Intergenic
910691773 1:89972758-89972780 GAAAAGGGAAAAATGAAGAGAGG + Intergenic
910705679 1:90127084-90127106 CAGAAGGCAAAGGGGAAGCACGG - Intergenic
911343645 1:96671076-96671098 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
911432922 1:97815013-97815035 GAAAAGGAAAGGAGGAAGGAAGG + Intronic
911638427 1:100261614-100261636 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
911760441 1:101608419-101608441 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
911847436 1:102772156-102772178 GGAAAGGCAAGGATGAGACAGGG - Intergenic
912010532 1:104955435-104955457 GAAAAGTCAAAGAACAAGCATGG - Intergenic
912022982 1:105129418-105129440 GAAAAGGAAAAAAGGAAGAAAGG + Intergenic
912555447 1:110512874-110512896 GAAAAGGGAATGATGAGGCCAGG + Intergenic
912930079 1:113950190-113950212 GGGAAGGCAAGGATTAAGCAAGG - Intronic
913398423 1:118398693-118398715 CGGAAGGCAAAGAGGAAGCAAGG - Intergenic
913451805 1:118997732-118997754 GAAAAGGCAAAAATAAAGAGGGG - Intergenic
913566131 1:120074334-120074356 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
913631999 1:120719219-120719241 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
914286719 1:146233693-146233715 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
914324199 1:146595539-146595561 TGAAAGGCAAAGAGGAAGCAAGG + Intergenic
914324780 1:146601865-146601887 TAAATGGCAAAGACGAATCAAGG + Intergenic
914536005 1:148566328-148566350 GAAAAGGTAAAGAATAAGCCAGG + Intronic
914547750 1:148684434-148684456 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
914822741 1:151117573-151117595 AAAAAAGAAAAGATGAAGAAGGG - Intronic
915058551 1:153159722-153159744 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
915248956 1:154575178-154575200 GAGATGACAAAGATGAATCAGGG + Intronic
915700429 1:157787667-157787689 GAAAGTGAAAAGATGAAGAAAGG + Intergenic
916078876 1:161219627-161219649 GAAAAGCCAAATATGCAGAACGG + Intronic
916127383 1:161583265-161583287 AAAAAGGAAAAGATGAGGAAAGG - Intronic
916137302 1:161665069-161665091 AAAAAGGAAAAGATGAGGAAAGG - Intronic
916604665 1:166328833-166328855 AAAAAGGAAAAGAAGAAGAAGGG - Intergenic
916766072 1:167861955-167861977 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
916818175 1:168373110-168373132 GAAAAGGCAAAGCTGAACACTGG - Intergenic
917351815 1:174085927-174085949 GAAAAGGAAAAAAGGAAGGAAGG - Intergenic
917683750 1:177394918-177394940 GAAAAGACTTAAATGAAGCAAGG + Intergenic
917726538 1:177833196-177833218 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
918238717 1:182603699-182603721 GAAAAAGTAAAGATGAAGGCAGG - Intronic
918469076 1:184851873-184851895 GGAAAGGCAAATATCAACCATGG - Intronic
918498113 1:185162084-185162106 GGAAAGGCAACACTGAAGCATGG + Intronic
918512652 1:185328342-185328364 GAGAAGGTGAAGAAGAAGCAAGG + Intergenic
918617524 1:186563144-186563166 GAACAGAGAAAAATGAAGCAAGG - Intergenic
918759068 1:188378064-188378086 CAGAAGGCAAAGGTCAAGCAAGG + Intergenic
918997927 1:191786281-191786303 GAAAAGTCAAAGTTTAAGGAAGG - Intergenic
919232520 1:194792346-194792368 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
919423257 1:197398423-197398445 AAAAAGGCAAAACTGAAGGAAGG + Intronic
919463380 1:197904268-197904290 CCACAGACAAAGATGAAGCAAGG - Intronic
920239115 1:204531089-204531111 GAAAAGAGATACATGAAGCAGGG + Intronic
920549842 1:206849144-206849166 CAAAAGTCAAAGATAAAGAAAGG + Intergenic
920631430 1:207656631-207656653 GGAAAGGCAAAGGGGGAGCAAGG + Intronic
921016199 1:211193615-211193637 TAAAAGGCAAAGATTAGGCTGGG - Intergenic
921145254 1:212349855-212349877 GAAAAACAAAAGATGAAGTAGGG + Intronic
921591095 1:217004454-217004476 CAGAAGGCAAAGGAGAAGCAAGG - Intronic
921647990 1:217642469-217642491 GAAAAAGCAAGGAAAAAGCAAGG - Intronic
921674203 1:217960059-217960081 TGAAAGGCAAAGGGGAAGCAAGG - Intergenic
921696388 1:218215290-218215312 GGGAAGGCAAAGGGGAAGCAAGG + Intergenic
921766472 1:218978476-218978498 GAAAAGGCATAGATATACCATGG - Intergenic
921875693 1:220193015-220193037 CAAAAGGCAAAGGTTAAACATGG + Intronic
922069266 1:222174879-222174901 GCGAAGACAAAGATGAAGGAAGG - Intergenic
922211017 1:223486937-223486959 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
922388382 1:225112551-225112573 GAGAAGGTAAAGATGAAGACAGG - Intronic
922569840 1:226627946-226627968 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
923084031 1:230688612-230688634 GGAAAGCCAAAGAGGAAGGAAGG + Intronic
923139509 1:231149120-231149142 GAAAAGGCACAGTTAAAACATGG - Intergenic
923242302 1:232097586-232097608 GAAAAGGCCAACATGCAGAATGG - Intergenic
923396333 1:233568735-233568757 TAAAAGACAAAGATGCAGCCAGG - Intergenic
923397300 1:233579675-233579697 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
923439880 1:234007230-234007252 GAAAAGGAAAACATTGAGCAGGG + Intronic
923496242 1:234527860-234527882 AAAAAGGCAATGATTAAACAAGG + Intergenic
924270048 1:242322746-242322768 CAAAAGGCAAAGGGGAAGCAAGG - Intronic
924288759 1:242515171-242515193 ACAAAGGCAAAGCTGAAGCATGG - Intronic
924940558 1:248810395-248810417 AAAGGGGCAAAGATGAGGCAAGG - Intergenic
1062865102 10:845918-845940 GAAAAGGCAAAGACAAAGTGGGG + Intronic
1062941472 10:1424676-1424698 TAAAAGGCACAGATGGGGCATGG + Intronic
1063310136 10:4944519-4944541 GAAGATGGAAAGATGAAGGAAGG + Intronic
1063317164 10:5017630-5017652 GAAGATGGAAAGATGAAGGAGGG - Intronic
1063567181 10:7180890-7180912 GAAAAGGCTAGGATGAACCCTGG + Intronic
1063755560 10:9003085-9003107 GAAGAGGCCAAGGTGAGGCAGGG - Intergenic
1063796118 10:9515759-9515781 GGAAAGGAAGAAATGAAGCAAGG + Intergenic
1063874753 10:10462456-10462478 AAAAAGGCAAAGAAGAAGCAGGG - Intergenic
1064038416 10:11935885-11935907 GAAAGGGCAAACAAGAAGAATGG + Intronic
1064573672 10:16722364-16722386 GAAAAGGATTTGATGAAGCATGG + Intronic
1064911166 10:20403398-20403420 GAAAAAGCAATAATTAAGCATGG - Intergenic
1065368973 10:24963479-24963501 AAAATGGCAAATATGAAGAATGG + Intergenic
1065468000 10:26045856-26045878 GGATAGGCACAAATGAAGCATGG - Intronic
1065797771 10:29322868-29322890 GAAAAGGAAAAAAGGAAGGAAGG + Intergenic
1066503923 10:36022425-36022447 GAAAAGGCCCAGATGCAGCAAGG + Intergenic
1066540155 10:36437815-36437837 GAAAAAGCAAAGATAAAGAATGG - Intergenic
1067043864 10:42973822-42973844 GAAATGGAAAAGATGCATCAGGG - Intergenic
1067252685 10:44601121-44601143 GCAGAGGGAAGGATGAAGCAAGG + Intergenic
1067726035 10:48771846-48771868 GAATAGGAAGAGAGGAAGCAGGG + Intronic
1067783570 10:49226714-49226736 CAAAAAGCAAAGATGGGGCAAGG + Intergenic
1068122492 10:52797317-52797339 CAGAAGGCAAAGTGGAAGCAAGG - Intergenic
1068189597 10:53634099-53634121 GAAAAGGCAAAAACAGAGCATGG + Intergenic
1068224782 10:54093287-54093309 GAAAAGATAAAAATGAAGAAAGG - Intronic
1068374684 10:56163756-56163778 TGAAAGGCAAAGGGGAAGCAAGG - Intergenic
1068381928 10:56265409-56265431 CAGAAGGCCAAGAAGAAGCAAGG + Intergenic
1068547264 10:58361565-58361587 GAAATGGCAAGAATGAAGTATGG - Intronic
1068617899 10:59140114-59140136 TAGAAGGGAAAAATGAAGCAAGG + Intergenic
1068765440 10:60758173-60758195 GAAAATACAAAGATAAAGCTAGG + Intergenic
1068801195 10:61141960-61141982 GAGAAGGTACAGATGAAACAGGG - Intergenic
1068875822 10:61995726-61995748 GAAAAGCCAAGGTTGAAGCTAGG - Intronic
1069054919 10:63834910-63834932 GAGAAGAGAAAGAAGAAGCAAGG - Intergenic
1069080642 10:64084860-64084882 GTCAAGGCAAAGATGCAGCAGGG - Intergenic
1069540037 10:69287214-69287236 GGGAAGGCAAAGGGGAAGCAAGG + Intronic
1069789570 10:71011049-71011071 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1069826637 10:71258774-71258796 GAAAAGGCAATGTTGGGGCAGGG - Intronic
1070165563 10:73895156-73895178 GAGAAGGCAATTATGAAGAAAGG + Intergenic
1070694025 10:78548537-78548559 GGAAAGGAAAAAATGAAGGATGG + Intergenic
1070896533 10:79987223-79987245 CAAATGTCAAAGATGAAGAAAGG + Intergenic
1071174669 10:82911252-82911274 GATAATGAAAAGATGAATCAAGG - Intronic
1071403757 10:85306820-85306842 TAAAAGGTTAAGAAGAAGCAAGG - Intergenic
1071666523 10:87564043-87564065 GCTAAGGCACAGGTGAAGCATGG + Intergenic
1071700365 10:87926123-87926145 GAAAAGGTAAAAAGGAAGGAAGG + Intronic
1071822568 10:89293226-89293248 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1071840622 10:89467118-89467140 GAAAAGCCTAAGAAGAAGCTAGG - Intronic
1071878979 10:89874148-89874170 TGAAAGGCAAAGGGGAAGCAAGG + Intergenic
1072639451 10:97200489-97200511 GATAAGGCACAGAAGGAGCACGG - Intronic
1072845926 10:98830332-98830354 GAAGAGGAAAAGATGAAGAAAGG + Intronic
1072919436 10:99563556-99563578 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1073662067 10:105487385-105487407 GATAAGTCAAAGATGAAGTTTGG + Intergenic
1073910721 10:108340547-108340569 GTCAAGGAAAAGATGAAGAAAGG + Intergenic
1073976880 10:109112234-109112256 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1074201476 10:111239917-111239939 GACAAGGCACACTTGAAGCAAGG + Intergenic
1074208049 10:111301614-111301636 CAGAAGGCAAAGGGGAAGCACGG - Intergenic
1074284050 10:112081152-112081174 GAAAAGGAAAGGAGGAAGGAAGG + Intergenic
1074706713 10:116139428-116139450 GAAAAGGCACACTTGAAGCCTGG - Intronic
1074735758 10:116431050-116431072 GAAAAGTCAAGGATGATGCAAGG - Intronic
1074886229 10:117695949-117695971 CAGAAGGCGAAGAAGAAGCAAGG - Intergenic
1075433204 10:122407647-122407669 GTAAAGGGAAAGGTGAGGCAAGG - Intronic
1075864052 10:125702655-125702677 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1076079226 10:127563676-127563698 GAAGAGGCAAAGCAAAAGCAAGG + Intergenic
1076182397 10:128420480-128420502 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1076210361 10:128636717-128636739 CAGAAGACAAAGAGGAAGCAAGG - Intergenic
1076326528 10:129627684-129627706 CAAGAGCCAAATATGAAGCATGG - Intronic
1077260130 11:1613239-1613261 GAGAATGAAAAGATGAACCAAGG - Intergenic
1078108842 11:8375782-8375804 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1078562455 11:12385005-12385027 AAGCAGGCAGAGATGAAGCAGGG + Intronic
1078674195 11:13394403-13394425 CAGAAGGCAAAGAGGAAGCAAGG - Intronic
1078865680 11:15295289-15295311 ATTAAGGCAAAGATGAACCAGGG - Intergenic
1078869317 11:15328824-15328846 GAAAAGGCAGAGTTGAGGCCTGG - Intergenic
1079034318 11:17009041-17009063 GAAAAAGCAAAGATGGAGTCTGG + Intronic
1079317908 11:19425379-19425401 GAAAAGGCATTCATGAAGAAGGG - Intronic
1079465414 11:20724943-20724965 TAGAAGGCAAAGGGGAAGCAAGG + Intronic
1079546709 11:21642164-21642186 CAAAAGGCAAAGAAGGAGCGAGG - Intergenic
1079551454 11:21703930-21703952 GGAAAGGCAAAAAAGAAGGAAGG - Intergenic
1079630022 11:22663053-22663075 GGAAAGGCAAAGGGGCAGCACGG + Intronic
1079742132 11:24076076-24076098 GAAAATGCAAAAACAAAGCAAGG + Intergenic
1079769862 11:24445381-24445403 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1079896575 11:26126760-26126782 CAGAAGGCAAAGGTGAAGAAAGG + Intergenic
1079898308 11:26149599-26149621 GACAAGCCCCAGATGAAGCAGGG + Intergenic
1079967047 11:26992689-26992711 GAAAAGAAACAGAGGAAGCATGG - Intergenic
1080091509 11:28354271-28354293 GAAAAGGCAAAGGGGAAAAAGGG - Intergenic
1080161649 11:29183858-29183880 GAAAAGGAAAGGATGCAGCAAGG - Intergenic
1080182375 11:29440849-29440871 GACAGGGCAGAGATGATGCAGGG - Intergenic
1080562506 11:33476815-33476837 GAAAAAGCAAAGATAAGACAGGG - Intergenic
1080791183 11:35524106-35524128 GCAAAGGCGAAGATGAAGTAGGG + Intronic
1080905956 11:36544883-36544905 CAGAAGGCAAAGGGGAAGCATGG - Intronic
1080928655 11:36784771-36784793 GAAAAGGAAAAGAGAAAGAAGGG - Intergenic
1080962272 11:37174398-37174420 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1081045311 11:38266905-38266927 CAAAAGGCAAAGCAGAAGCAAGG - Intergenic
1081218340 11:40430000-40430022 GGCAAAGCCAAGATGAAGCAGGG - Intronic
1081405979 11:42698265-42698287 AAAAAGGCAGGGAGGAAGCAAGG + Intergenic
1081517337 11:43845968-43845990 GAAAAGTCACAGCTAAAGCATGG + Intronic
1081590626 11:44420545-44420567 GAAAAGGGAAAACTGAGGCAGGG - Intergenic
1082194162 11:49282030-49282052 GATCAGGCAAAGTTAAAGCATGG + Intergenic
1082864325 11:57884741-57884763 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1083237914 11:61363622-61363644 GAAAAAGCAGAGAGGAAACAGGG - Intronic
1083428093 11:62599649-62599671 GAAAAGGGAAAGATGTAAAATGG + Intronic
1083435243 11:62638569-62638591 GAAAAGGAAAGGAGGAAGGAAGG + Intronic
1084020610 11:66415147-66415169 GAACAGGCAATGAGGAGGCAGGG - Intergenic
1084058529 11:66653894-66653916 AAAAAGGCAAAAAATAAGCAGGG + Intronic
1084145050 11:67260800-67260822 GGAAAGGCAAAGAGGTAGAAAGG + Intergenic
1084277792 11:68063853-68063875 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1084788069 11:71455236-71455258 GAGAAGGCAAGGAAGGAGCAGGG + Intronic
1085000481 11:73028876-73028898 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1085333602 11:75672696-75672718 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1085677744 11:78540627-78540649 GAATACATAAAGATGAAGCATGG + Intronic
1086083252 11:82927513-82927535 CAAAAGGCAAACAGAAAGCAAGG - Intronic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1086568914 11:88260824-88260846 AAAAAGACAAAGATGAACAAGGG - Intergenic
1086671991 11:89559004-89559026 GATCAGGCAAAGTTAAAGCATGG - Intergenic
1086996897 11:93368494-93368516 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1087474830 11:98622127-98622149 GAAAAGGGGAAGAGGAAGAAGGG - Intergenic
1087720812 11:101663851-101663873 GAAAGGTCAAAGATGAAGAAAGG - Intronic
1087725605 11:101712767-101712789 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1088072665 11:105809669-105809691 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1088415223 11:109581234-109581256 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1088426706 11:109712737-109712759 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1089389259 11:118088915-118088937 GAAGATGCAAAGCTGAAACAAGG - Intronic
1089398302 11:118150001-118150023 GAAAAAGGAAAGAAGAAGCAAGG - Intronic
1089465098 11:118679815-118679837 GAAGAGGCAAAGTAGAAGCAAGG - Intergenic
1090065470 11:123499618-123499640 GAAATGGCAAAGAAAAAGAAAGG - Intergenic
1090087107 11:123660105-123660127 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1090714229 11:129416032-129416054 TAAAAGTCAAAGATGAAACAGGG - Intronic
1091057185 11:132430145-132430167 GAAAAGGCACGGGTGAGGCATGG + Intronic
1091542249 12:1472694-1472716 GAAAAGGAAAAAAGGAAGGAAGG + Intronic
1091688257 12:2578914-2578936 GGGAAGGCAGAGATGGAGCATGG - Intronic
1091967506 12:4757094-4757116 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1092234849 12:6800230-6800252 GGAAAGGCAAAGGTGGAGGATGG + Intronic
1093274681 12:17109594-17109616 AACAAAGCAAAGATCAAGCAAGG + Intergenic
1094451051 12:30583462-30583484 GAAAAGAGAAAGATGATGGAAGG + Intergenic
1094484494 12:30913772-30913794 TAGAAGACAAAGAAGAAGCAAGG + Intergenic
1095044384 12:37484816-37484838 CAAAAGGTAAAGGAGAAGCAAGG + Intergenic
1095418351 12:41999637-41999659 GAAGTGGAAAGGATGAAGCAGGG + Intergenic
1095600578 12:44008643-44008665 GAAAAGCCACAGAAGAAGGAAGG - Intronic
1095658080 12:44695021-44695043 TAAAAGGAAAAAATGAAGGAAGG + Intronic
1095731400 12:45510615-45510637 CAAAAGGCAAAGGGGAAGCAAGG + Intergenic
1095919271 12:47513251-47513273 CAGAAAGCAAAGAAGAAGCAAGG - Intergenic
1095940434 12:47723525-47723547 GGAAAGGCTCAGATGAAGAAAGG - Intronic
1096258915 12:50078891-50078913 GAAAAGACAATGATGCAGGATGG - Intronic
1096292934 12:50357581-50357603 CAAAAGGCAAAGATAAAACAGGG + Intronic
1096344423 12:50833123-50833145 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1097326330 12:58281472-58281494 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1097393678 12:59047097-59047119 GAAAAGGTAAATAGGAAACAAGG - Intergenic
1098430033 12:70408961-70408983 GTTAAGGCAAAGATGAAGAAAGG - Intronic
1098587829 12:72175552-72175574 GGAAAGGCAAGGATGCAGCCGGG - Intronic
1098603846 12:72365976-72365998 GAAGATGCAAAGATGGAGAAAGG - Intronic
1098739152 12:74148898-74148920 GAAAAATAAAATATGAAGCATGG - Intergenic
1098853930 12:75630682-75630704 GAAAAGGAAATAAAGAAGCAAGG - Intergenic
1098940658 12:76531119-76531141 CAGAAGGCAAAGGGGAAGCAGGG + Intronic
1099253142 12:80283349-80283371 GAAAAGACATAGATGAGGGATGG - Intronic
1099314067 12:81063101-81063123 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
1099616437 12:84941553-84941575 GGAAAGGAAAAGAAGAAGGAGGG + Intergenic
1099671776 12:85702938-85702960 TAGAAGGCAAAGGTGAAGCAAGG - Intergenic
1099790010 12:87321951-87321973 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1100352798 12:93800623-93800645 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1100426492 12:94491937-94491959 GAAAGAGGAAAGATGATGCAAGG + Intergenic
1101095438 12:101334222-101334244 AAAATGGCAAAGGTGATGCATGG - Intronic
1101701504 12:107178449-107178471 GGACAGGAAAAGATGAAGCAGGG - Intergenic
1101939138 12:109086488-109086510 GAAAAGGCATAGAAAAAGGAAGG - Exonic
1102141916 12:110622286-110622308 GAAAAGGAAAGGAAGAGGCAAGG - Intronic
1102341797 12:112127177-112127199 GAAAAGACAAAGATAGAGGATGG - Intronic
1102393299 12:112567117-112567139 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1102451512 12:113045113-113045135 GAAAGGGGAAAGAGGAAGAAAGG + Intergenic
1102590421 12:113952262-113952284 GCAAAGGCTAAGATGAGGAAGGG + Intronic
1102658442 12:114503567-114503589 AAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1102748604 12:115272162-115272184 GAAAAGAGAAAGAGGAAGGAAGG + Intergenic
1102834434 12:116041296-116041318 TAGAAGGCAAAGGGGAAGCAAGG - Intronic
1103086696 12:118066985-118067007 GAAGAGGTAGACATGAAGCAAGG - Intronic
1103513883 12:121494259-121494281 GAAAAGGAAGGGAAGAAGCAAGG + Intronic
1104169889 12:126269907-126269929 GAAAAGGCAAAAATGAAGAAAGG - Intergenic
1104330806 12:127842964-127842986 GAAAAGAAAAAGATGGATCAAGG - Intergenic
1104548950 12:129738394-129738416 GAAAAGGAAAAAAGGAAGAAAGG + Intronic
1104593224 12:130101223-130101245 GAAAAGGCAGAGAGGACTCACGG - Intergenic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1105529081 13:21201940-21201962 CAGAAGGCAAAGAGGAAGCAGGG + Intergenic
1106073791 13:26440104-26440126 AAAGAGGCAGAGATGAACCAGGG + Intergenic
1106112800 13:26791897-26791919 TGGAAGGCAAAGAAGAAGCATGG - Intergenic
1106297486 13:28429857-28429879 GAAAAGGAAATAATGTAGCAAGG - Intronic
1106332751 13:28754520-28754542 CTAAGGGCAAAGATGAAGCTGGG + Intergenic
1106532564 13:30607466-30607488 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1106910341 13:34456422-34456444 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1107041371 13:35951446-35951468 GAACAGGCAAAGAGTAAGAAAGG - Intronic
1107681360 13:42855119-42855141 GAATAGGGAAAGATTAAGTAAGG + Intergenic
1108110288 13:47064329-47064351 GAAAAGAGAAAAATGAAGAAAGG + Intergenic
1108211973 13:48148392-48148414 AAATAGGCAAAAATTAAGCAGGG + Intergenic
1108460210 13:50658367-50658389 TAAAAAAGAAAGATGAAGCAAGG - Intronic
1108751077 13:53449091-53449113 GAAAAGGCCAAAATGGAGGAAGG - Intergenic
1108809359 13:54202323-54202345 GAATTGGCAAAGCTGAAGAAAGG + Intergenic
1108846338 13:54681997-54682019 GAAAAGACAAACATGCAGAAAGG - Intergenic
1108968389 13:56341233-56341255 GCAAAGGTAAAGGAGAAGCAAGG + Intergenic
1108975978 13:56443656-56443678 AAAAGGGCAAAAATGAGGCAAGG + Intergenic
1109122740 13:58478486-58478508 TAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1109193734 13:59355204-59355226 AAGAAGGCAAAGAGGAAACAAGG - Intergenic
1109195351 13:59372310-59372332 TGAAAGGCAAAGGAGAAGCAAGG - Intergenic
1109360376 13:61287311-61287333 CCAAAGGCAAAGGAGAAGCAGGG + Intergenic
1109718493 13:66247071-66247093 CAGAAGGCAAAGAGGAAGGAAGG - Intergenic
1109873129 13:68363680-68363702 GAAAAGGAAAAGACAAAGAAGGG + Intergenic
1110169654 13:72485387-72485409 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1110303530 13:73957119-73957141 GAAAAGGAAAGGAGGAAGGAAGG + Intronic
1110305645 13:73984130-73984152 GAAATGGCAGAGAAGAGGCAAGG + Intronic
1110373679 13:74767557-74767579 GAAAATGCAAAGATGACATATGG + Intergenic
1110490304 13:76095924-76095946 GGAAAGGAAAAGAAGAAGGAAGG - Intergenic
1110610314 13:77480518-77480540 GAAGAGACAAGGATGCAGCAAGG - Intergenic
1110759340 13:79213803-79213825 GGAAAGGCTGAGATGAAGCTCGG - Intergenic
1110846517 13:80195886-80195908 GAAAAAGAAAAGAGGAAGGAAGG + Intergenic
1110941634 13:81358228-81358250 AAAAAGGAAAAAATGAAGGAAGG - Intergenic
1111082043 13:83323214-83323236 GAGAAGGTGAAGAGGAAGCAAGG + Intergenic
1111189443 13:84789346-84789368 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1111234463 13:85390541-85390563 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1111364899 13:87230159-87230181 GAAAAGGCAGACAAGAAGGAAGG - Intergenic
1111533248 13:89568823-89568845 TAAAAGGCAAAGGGGAAGCAAGG + Intergenic
1111808689 13:93070197-93070219 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1112106638 13:96247511-96247533 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
1112257876 13:97851245-97851267 CAAAAGGCGAAGGGGAAGCAAGG + Intergenic
1112942945 13:104888519-104888541 GGGAAGGCAAAGGGGAAGCAAGG - Intergenic
1113067526 13:106387384-106387406 GAAAATGAAAAGATGATTCAGGG + Intergenic
1113106415 13:106776175-106776197 GAAAAAGCAAAGCTGAAAGATGG + Intergenic
1113136416 13:107095423-107095445 GAAAAAGAAGAGATGAAGAAGGG - Intergenic
1113177564 13:107582511-107582533 GAAATGTCAAAAATCAAGCACGG + Intronic
1113402642 13:110008161-110008183 GAACAGGCAAAGTTTAAACATGG + Intergenic
1113710753 13:112463501-112463523 GAAAAGGCACAGATCAAGAAAGG + Intergenic
1113834868 13:113322172-113322194 CAAAAGGCAAAGAGGAACCCTGG - Intronic
1114139226 14:19892699-19892721 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1114347303 14:21809418-21809440 TGAAAGGCAAAGCTGAAGCACGG - Intergenic
1114521320 14:23338992-23339014 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1114590660 14:23861697-23861719 TGAAAGGCAAGGAGGAAGCAGGG + Intergenic
1114689202 14:24564389-24564411 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1114758954 14:25290339-25290361 GGAAAGGCAAATAAGGAGCATGG + Intergenic
1114775892 14:25480906-25480928 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1114919882 14:27312858-27312880 CAAAATGCACAAATGAAGCAAGG - Intergenic
1115669378 14:35591969-35591991 CAAAAGGCAAAGGGGAAGCAAGG - Intronic
1115841975 14:37482525-37482547 CAAAAGGTAAAGGGGAAGCAAGG + Intronic
1115962382 14:38850098-38850120 GGAAAGGCAAAGAAGAGGCAGGG + Intergenic
1116046191 14:39746013-39746035 GAAAAGGCAGAGTTTCAGCAGGG - Intergenic
1116132500 14:40874501-40874523 AACAAGGCGAAGGTGAAGCAAGG - Intergenic
1116428202 14:44815967-44815989 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1116464680 14:45217562-45217584 GAAGAGGCTAAGATTAGGCAGGG + Intronic
1116603337 14:46956958-46956980 CAAAAGGCAAAGGGGAAGCAAGG - Intronic
1116606858 14:47010099-47010121 GTAAAGGCAAAGATGCCACAGGG - Intronic
1116749851 14:48869480-48869502 GAAAATTCAAAGAAGCAGCAGGG + Intergenic
1116982370 14:51185200-51185222 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1117025828 14:51619395-51619417 GGAAAGGAAAAGAAGAAGAAAGG + Intronic
1117304221 14:54458327-54458349 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1117792021 14:59351131-59351153 GAAGAGTCAAAGATGACGCCTGG - Intronic
1118009382 14:61593946-61593968 GCAAAGGCAAAGAGGAAGCATGG + Intronic
1118459828 14:65977553-65977575 GAAAAGGCAAAGAAGGGTCAAGG + Intronic
1118499581 14:66346482-66346504 GAAAAGGCAAACATTAAGCAAGG - Intergenic
1119066919 14:71537666-71537688 GAAAAGGAAATGAAGATGCAGGG - Intronic
1119180345 14:72600931-72600953 AAAGAGGCAAAGATGAAGTGGGG + Intergenic
1119936481 14:78596775-78596797 CTAAAGGCAATGATGATGCAAGG - Intronic
1119938928 14:78619699-78619721 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
1120003026 14:79325092-79325114 GAAAAGAGAAAGACAAAGCATGG - Intronic
1120007021 14:79370060-79370082 GAAAAGACAAACATGAAGTAAGG + Intronic
1120257739 14:82141455-82141477 CAAAAGGCAAAGAGAAAGCAAGG + Intergenic
1120453962 14:84707919-84707941 CAGAAGGCAAAGTGGAAGCAAGG + Intergenic
1120474989 14:84975720-84975742 GAAAAGGCAACTTTGAAGGAGGG - Intergenic
1120593689 14:86407309-86407331 TAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1120625465 14:86820186-86820208 GAAAAGGGAAATATGAATAAGGG + Intergenic
1120642299 14:87029817-87029839 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1120696507 14:87650754-87650776 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1120724425 14:87922016-87922038 CAGAAGGCAAAGGTGAAGCAAGG - Intronic
1120906677 14:89626750-89626772 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1121240859 14:92428966-92428988 GAAAAGGCAAATATGGGGAAAGG + Intronic
1121512842 14:94525426-94525448 GAAAAGGAGAAGAGGAAGGAAGG + Intergenic
1121698637 14:95934174-95934196 GAAAAGTCAAAGATGACACAGGG + Intergenic
1121925518 14:97923808-97923830 GAAAAGGCAAGAAAGAAGTAAGG - Intergenic
1122314062 14:100815384-100815406 AACAAGGCAAAGATGTAACAAGG - Intergenic
1122657632 14:103273152-103273174 GAAAAGGCAAGGAAAAGGCAAGG + Intergenic
1122979175 14:105183716-105183738 GCAAAGGCAAAGGCAAAGCAAGG + Intergenic
1124899604 15:33809965-33809987 GAAAAGGAAAATCTAAAGCAGGG - Intronic
1125065941 15:35486442-35486464 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1125231381 15:37461403-37461425 CAGAAGGCAAAGGAGAAGCAAGG + Intergenic
1125270044 15:37928895-37928917 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1125278418 15:38017980-38018002 CAAAAGGCAAAGGGGAAGCAAGG - Intergenic
1125376823 15:39039112-39039134 AAAATGGCAAAGAAGAAGCTTGG - Intergenic
1125398819 15:39278509-39278531 GAGAAGGCAAAGCAGAAGCAAGG + Intergenic
1125698442 15:41659466-41659488 TAAAAGGCAAAAAAGAAGTAGGG - Intronic
1126255589 15:46621689-46621711 AAAAAGCCCAAGAGGAAGCATGG + Intergenic
1126305487 15:47250979-47251001 TAAAAAGCAAATGTGAAGCAAGG - Intronic
1126570406 15:50144450-50144472 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
1126621173 15:50641428-50641450 GAAATGGAAATGAGGAAGCAAGG - Intronic
1127250222 15:57227151-57227173 GATAAGACAAAGTTAAAGCATGG - Intronic
1127468821 15:59271963-59271985 CAAAGGGCAAAGATGATGCCCGG - Intronic
1127637542 15:60885864-60885886 GAGAAAGCAAATGTGAAGCACGG + Intronic
1127674729 15:61228607-61228629 GAAAAGGTAAAGCGGAAGGAGGG + Intronic
1127676687 15:61246279-61246301 GACAAGGCAGAGCTAAAGCATGG + Intergenic
1127721890 15:61710271-61710293 GAAAAGGAAAATCTCAAGCAAGG + Intergenic
1128284966 15:66429237-66429259 CATAAGGCAAAGGGGAAGCAAGG + Intronic
1128522163 15:68382592-68382614 GAAGAGGCCAAGATGAATAAAGG + Intronic
1128665063 15:69531795-69531817 GATAGGGCCAAGATGAAGCCCGG + Intergenic
1129025264 15:72566239-72566261 AAAAATGCACTGATGAAGCATGG + Intronic
1129160875 15:73747035-73747057 GAAAGGTCAAAGAGGGAGCAGGG - Intronic
1129538041 15:76330144-76330166 GAGATGGGAAAGATGAGGCAGGG - Intergenic
1129560304 15:76559433-76559455 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1129949049 15:79570108-79570130 GAAAGGGAAAAGAGGAAGGAGGG + Intergenic
1130099506 15:80881800-80881822 GCAAAAGCAAAGATGGTGCAGGG + Intronic
1130448634 15:84028950-84028972 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
1130717503 15:86349794-86349816 AAAAAGACATAGAAGAAGCATGG + Intronic
1130741180 15:86602038-86602060 GAGAAGGGAAAGAAGAAGGAAGG - Intronic
1131081403 15:89539278-89539300 GAAAAGGAAAGGAAGAAGGAAGG + Intergenic
1131773332 15:95765211-95765233 CAGAAGGCAAAGAAGAAGCAAGG + Intergenic
1132230773 15:100182207-100182229 CCAAAGGCAAAGGGGAAGCAAGG + Intronic
1132272342 15:100537516-100537538 CAAAAGGTGAAGAGGAAGCAAGG + Intronic
1133240300 16:4410127-4410149 AAAAAGTCAAACATGAAGCCAGG + Intronic
1133636913 16:7675637-7675659 GATAAGACATAGATGAAGCAGGG - Intronic
1133650780 16:7812485-7812507 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1133911331 16:10069136-10069158 GCAAAGGAAAGGATGAAGTAGGG + Intronic
1134332456 16:13263502-13263524 CAGAAGGCAAAGAGGTAGCAGGG - Intergenic
1134409557 16:13992745-13992767 GAAAGTGCAAAGTTGAAGCCTGG + Intergenic
1134540819 16:15063827-15063849 GAAAATGGAAAGATGAAAAACGG - Intronic
1134610258 16:15602591-15602613 AAAAAGACAAAGAAGAAGAAAGG + Intronic
1134741056 16:16545873-16545895 GAAAAGACAAAAATGAACAAAGG - Intergenic
1134896198 16:17889097-17889119 GAAAAGGCAAAGGAGAAGAAAGG - Intergenic
1134926442 16:18166250-18166272 GAAAAGACAAAAATGAACAAAGG + Intergenic
1135147541 16:19975771-19975793 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1135393876 16:22116266-22116288 GAAAAAGAAAAGAAGAAGGAAGG + Intronic
1135505561 16:23033129-23033151 GAAAAGGAAAAGAGGAAGTGAGG + Intergenic
1135684363 16:24486432-24486454 GAAAAGTGAAGGATGAAGCATGG - Intergenic
1135742461 16:24987789-24987811 TAAAATGAAAAAATGAAGCATGG + Intronic
1135754773 16:25087824-25087846 TAAAATGAAAAAATGAAGCATGG + Intergenic
1135869107 16:26132695-26132717 AAGAAGGCAAAGGTGAAGAATGG + Intronic
1136065452 16:27755323-27755345 CAGAAGGCAGAGATGGAGCAGGG - Intronic
1136263992 16:29103510-29103532 GAAAATGGAAAGATGAAAAATGG + Intergenic
1137273762 16:46919904-46919926 GAAGAGTCAAAGATGAATCCTGG + Intronic
1137377693 16:47967643-47967665 GTAGATGCAAGGATGAAGCAAGG - Intergenic
1137382340 16:48011116-48011138 CAGAAGGCAAAGGAGAAGCAAGG + Intergenic
1137649909 16:50110864-50110886 GAAAATGCTAAGATGACGCTTGG + Intergenic
1137840056 16:51632474-51632496 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1137859768 16:51834768-51834790 CAAAATGCCAAGATGAACCAGGG - Intergenic
1138729173 16:59176039-59176061 GAAAAAGCAAAGCTGAGGCCAGG + Intergenic
1139858365 16:69999646-69999668 GAAAATGCAAAAATTAAGCCGGG - Intergenic
1140008783 16:71109081-71109103 TAAATGGCAAAGATGAATCAAGG - Intronic
1140009359 16:71115306-71115328 TGAAAGGCAAAGAGGAAGCAAGG - Intronic
1140126921 16:72125412-72125434 GAAAAGACAAAGAGGACGAATGG + Intronic
1140284108 16:73584633-73584655 GTAAAGTCAAAGATGAAGACGGG + Intergenic
1140330926 16:74056059-74056081 AAAAAGGCAAATATGAAGCTGGG + Intergenic
1141371355 16:83489088-83489110 CACAAGAAAAAGATGAAGCATGG + Intronic
1141878607 16:86842987-86843009 GGAAAGGCAGAGATGGGGCAGGG + Intergenic
1141882891 16:86871658-86871680 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
1142348230 16:89567858-89567880 CAAAAGGAAAAGAGCAAGCAGGG - Intergenic
1142898961 17:3000630-3000652 GAGAAGGGACAGAAGAAGCAGGG + Intronic
1142898980 17:3000729-3000751 GAGAAGGGACAGAAGAAGCAGGG + Intronic
1142899021 17:3000927-3000949 GAGAAGGGACAGAAGAAGCAGGG + Intronic
1142899039 17:3001026-3001048 GAGAAGGGACAGAAGAAGCAGGG + Intronic
1142899078 17:3001224-3001246 GAGAAGGGACAGAAGAAGCAGGG + Intronic
1142899097 17:3001323-3001345 GAGAAGGGACAGAAGAAGCAGGG + Intronic
1142899115 17:3001422-3001444 GAGAAGGGACAGAAGAAGCAGGG + Intronic
1142899133 17:3001521-3001543 GAGAAGGGACAGAAGAAGCAGGG + Intronic
1142899151 17:3001620-3001642 GAGAAGGGATAGAAGAAGCAGGG + Intronic
1143385553 17:6527992-6528014 CAAAAGCCAAAGATGGAGCAGGG - Intronic
1143935920 17:10483915-10483937 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1143992958 17:10982214-10982236 GAAATGCCAGAGATGAAACAAGG - Intergenic
1144159677 17:12545427-12545449 GAAAAGGCAAAGCTATAGAATGG - Intergenic
1144731087 17:17526691-17526713 GAAAGGGCAGGGAAGAAGCATGG - Intronic
1145302440 17:21650062-21650084 GAACAGGCAGAGTTGAAGCTGGG - Intergenic
1145347879 17:22053246-22053268 GAACAGGCAGAGTTGAAGCTGGG + Intergenic
1145415715 17:22712136-22712158 GAAAAGGCAGAGTTGAAGCTGGG - Intergenic
1145726118 17:27126444-27126466 GAAAAAGAAAAGATGAAGAAAGG + Intergenic
1146086784 17:29837800-29837822 GGAAACGCAAAGAGGAGGCATGG + Intronic
1146445693 17:32931277-32931299 GAAAAGGCAAATTTGGGGCATGG + Intronic
1146472489 17:33135596-33135618 GAAGGGGCAAAGATGGAGCCAGG + Intronic
1146681131 17:34809154-34809176 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1147026296 17:37587510-37587532 GAAAAGGTTTAGAAGAAGCAAGG - Intronic
1148004784 17:44418152-44418174 GAAAAGAAAAAGAGGAAGAAAGG + Intronic
1148222309 17:45871690-45871712 TGAAAGGCAAAGGGGAAGCAAGG - Intergenic
1148458873 17:47826400-47826422 GGAAAGGCAGACATGGAGCAGGG - Intronic
1149141591 17:53438295-53438317 TGGAAGGCGAAGATGAAGCAAGG + Intergenic
1149169775 17:53795232-53795254 GAAAGGGGAAAGAAGAAGAAAGG + Intergenic
1149514235 17:57267984-57268006 GAAAAGATAATGATGAAGCTGGG - Intronic
1149704953 17:58686581-58686603 GAAAAGCCAAATATGTAGAAAGG + Intronic
1150011476 17:61508594-61508616 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1150019719 17:61599329-61599351 GAATAGGGCAAGCTGAAGCATGG + Intergenic
1150843919 17:68635402-68635424 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1151058416 17:71061003-71061025 TGAAAGGCAAAGAGGAAGCAAGG - Intergenic
1152343809 17:79739542-79739564 GAAAATGCAAAAATGAAAGATGG + Intronic
1153163664 18:2238133-2238155 TGAAGGGAAAAGATGAAGCAGGG - Intergenic
1153538821 18:6133513-6133535 GAAAAAGGAAAGATGAGGGAGGG - Intronic
1154489400 18:14908125-14908147 GAATAAGCAAAGAGGAGGCATGG + Intergenic
1155102553 18:22626760-22626782 CAAAAGGCAATGATAAAGCTGGG + Intergenic
1155725873 18:29082447-29082469 AAAAAGGTTAAGATGAAGCCGGG - Intergenic
1156466200 18:37349091-37349113 GAAAAGTCAGGGATGAAGCAGGG + Intronic
1156797013 18:41058290-41058312 AAATTGGCAAAGATTAAGCAAGG - Intergenic
1158091519 18:53719721-53719743 GCATAGTCAAAGATTAAGCAGGG - Intergenic
1158353241 18:56586812-56586834 CAGAAGGCAAAGGTGAATCAAGG - Intergenic
1158438474 18:57451921-57451943 GAAAAGGCAAGCATGAGGAATGG + Intronic
1158694015 18:59687104-59687126 GAAAATTCCAAAATGAAGCAAGG + Intronic
1158956313 18:62543122-62543144 GAAAAGGCGTAGCTCAAGCAGGG - Intronic
1159229683 18:65590379-65590401 GGAAAAGCAAAGATGAAGAAAGG + Intergenic
1159265630 18:66074762-66074784 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1159306605 18:66651554-66651576 TAAAAGGCAAAGATGATGAGAGG - Intergenic
1159383543 18:67692356-67692378 TAAAAGGTAAAGAAGAAACATGG - Intergenic
1159408044 18:68032126-68032148 GAAAAGGCAGACATGAAGCAAGG - Intergenic
1159433826 18:68389660-68389682 GCAAAGACAAACATGAAGCTTGG + Intergenic
1159940948 18:74407986-74408008 AAAAAGGAAATGATGAAGAAAGG - Intergenic
1159986142 18:74843463-74843485 GAAAAAGTAAAGATGAAGTGTGG - Intronic
1160006783 18:75074111-75074133 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1161165907 19:2787236-2787258 GAAAAGCCAAGGATCAGGCAAGG - Intronic
1162051602 19:8037285-8037307 GAAAAGAGAAAGAAGAAGCTGGG - Intronic
1162764331 19:12909145-12909167 GAAGATACAAAGATGAAGGATGG - Intronic
1164437536 19:28244368-28244390 GAAAAGCCTAAGATGAAGCAAGG - Intergenic
1164573446 19:29390730-29390752 GAAAAAGAAAAGAAGAAGAAAGG + Intergenic
1164665251 19:30027363-30027385 TAAAAGGCAAGGAAGAAGAAAGG - Intergenic
1164931140 19:32177260-32177282 GAAAAGGCAATGAGGGAGCTGGG + Intergenic
1165283078 19:34814648-34814670 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1165468837 19:35991379-35991401 GAAAAGGCGAGGATGAAAGATGG - Intergenic
1167046077 19:47049452-47049474 GAGAAGGCAAAGCTGAATCCCGG - Intergenic
1167813359 19:51854885-51854907 GAATAAGCAAATATGAAGCTAGG - Intergenic
1168106933 19:54171518-54171540 GAGGAGGCAAAGATGAAGGAAGG + Intronic
925065749 2:927954-927976 AATAAGGAAAAGATGACGCAGGG + Intergenic
925178272 2:1799950-1799972 CAGAAGGTAAAGAGGAAGCAAGG - Intronic
925236360 2:2281221-2281243 CAGAAGGCAAAGCTGAAGAAAGG - Intronic
925576826 2:5369010-5369032 GAAAAGGAAAAAAGGAAGGAAGG - Intergenic
926653421 2:15371205-15371227 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
926753040 2:16214249-16214271 GTAAAAGCAAAGATCAAGCCTGG - Intergenic
926753129 2:16215204-16215226 GAAAAGGTAAAGTTGAAATACGG - Intergenic
926824566 2:16891139-16891161 TAGAAGGCAAAGGGGAAGCAAGG - Intergenic
926839213 2:17059881-17059903 GAAAAGGAAAAAAGGAAGAAAGG + Intergenic
927166615 2:20329452-20329474 GAAAAGACAAAGAAAAAGAAAGG + Intronic
927191103 2:20517441-20517463 GTAAAGCCAAACATCAAGCAGGG + Intergenic
927444797 2:23149643-23149665 GCAAAGGCAAAGAAGAAGCAAGG - Intergenic
927912302 2:26908887-26908909 GAAAAGAAAAAGAGGAAGAAGGG - Intronic
928359633 2:30652857-30652879 GAGAAGGAAAATATCAAGCAGGG + Intergenic
928787967 2:34913872-34913894 GAAAAGGAAGAAAGGAAGCATGG - Intergenic
928849654 2:35729777-35729799 CATAAGGCAAAGGGGAAGCAAGG + Intergenic
929018215 2:37523513-37523535 AAAAAGGGAAAGAAAAAGCAAGG + Intergenic
929040158 2:37736890-37736912 CAAAAGGCAAAGGGGAAGCAGGG + Intronic
929612642 2:43283146-43283168 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
929766793 2:44850386-44850408 GTAAAGTCAAAAATGAATCAGGG + Intergenic
929779081 2:44946262-44946284 AAAAAGGCAAAGATGGTTCAAGG + Intergenic
929898394 2:45981123-45981145 GAAAATGCAACAATGAAGCTAGG + Intronic
930335164 2:50036309-50036331 TGAAAGGCAAAGGGGAAGCAAGG - Intronic
930576828 2:53160830-53160852 GAAAATGCAAAGTTGCAGAAGGG - Intergenic
930902183 2:56521048-56521070 GAAAAGGAAGAGTAGAAGCAAGG + Intergenic
931277937 2:60760586-60760608 GAAAATTTAAAGATGAAGGAGGG + Intronic
931320009 2:61166798-61166820 AAAATGGCTAAGATGAAGCCTGG - Intergenic
931548742 2:63418698-63418720 GAAAAGGCAAACAGTAAGAAGGG + Intronic
931884608 2:66603495-66603517 GAAAAGGAAGAGAAGAAGGAAGG - Intergenic
932163593 2:69485591-69485613 CAAAAGGCATAGATGTGGCAGGG - Intronic
932454671 2:71841635-71841657 GTAAAGACATAGATGAAGAATGG - Intergenic
932534069 2:72573077-72573099 GACAAGGCAAAGAAGGAGCATGG + Intronic
932675149 2:73773413-73773435 GAAAGGGCAAAGATTAAGAATGG - Intronic
932872796 2:75420287-75420309 GAAAAGAAAAAGAAAAAGCAAGG - Intergenic
933047204 2:77554098-77554120 GAAAAGGGAGAGATGGGGCAAGG - Intronic
933634712 2:84694732-84694754 GAAAAGGCAAAGATAACAGAAGG + Intronic
933933724 2:87182003-87182025 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
934506184 2:94896605-94896627 GAAAAGCCACAGAAGAGGCAGGG + Intergenic
935366174 2:102293192-102293214 GAAGAGGCAAAGAGAAAGGAAGG + Intergenic
935536194 2:104297554-104297576 GGAAAGGTAAACATGAAGCCTGG + Intergenic
935691398 2:105735525-105735547 CAGAAGGCAAAGCAGAAGCAAGG + Intergenic
936014636 2:108948574-108948596 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
936359386 2:111783441-111783463 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
936558893 2:113519476-113519498 GCAAAGGCCATGATGAAGAAGGG - Intergenic
936734493 2:115425090-115425112 AAAAAGGCAGAGATGAATGAGGG + Intronic
936926571 2:117743012-117743034 GAAAAGGCAGAAAAGAAGAAAGG + Intergenic
937368448 2:121281872-121281894 CAAAAGGCAAACAGGAAGGAAGG + Intronic
937622746 2:124007620-124007642 GAAAGGAGAGAGATGAAGCAGGG + Intergenic
937811851 2:126208119-126208141 CAGAAGGTAAAGAGGAAGCAAGG - Intergenic
937847638 2:126599100-126599122 CAAAAGGAAAAAATGAACCAAGG + Intergenic
937935114 2:127237776-127237798 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
938812483 2:134866526-134866548 GAAAAGGGTAAGTTGAAGAAAGG - Intronic
938960304 2:136334867-136334889 GCAAAGGCAAAGGGGGAGCAAGG + Intergenic
939097346 2:137849049-137849071 AAAAAGGAAAAGAGGAAGGAAGG + Intergenic
939209093 2:139148416-139148438 GAAAATGCAATGACGTAGCAAGG + Intergenic
939254505 2:139724804-139724826 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
939264425 2:139853011-139853033 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
939803798 2:146748038-146748060 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
939887946 2:147701684-147701706 CAGAAAGCAAAGAAGAAGCAAGG + Intergenic
940446613 2:153785110-153785132 GAAACAGCAAAGATGGAGCTTGG - Intergenic
940610280 2:155981302-155981324 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
940685005 2:156837880-156837902 CAGAAGGCAAAGAAGAAACAAGG - Intergenic
940697505 2:156997901-156997923 GAAAGGGCAAAGAGAATGCAAGG + Intergenic
940769714 2:157826843-157826865 GAAAAGGAAAAGAAGAAGGAAGG + Intronic
940786172 2:157983681-157983703 CAAAGGTCAAAGATGAAGAAAGG - Intronic
940889894 2:159025254-159025276 GAAAAGGAAAAAAGGAAGGAAGG - Intronic
941135113 2:161706384-161706406 GAAAAGCGAAACATCAAGCAAGG - Intronic
941153934 2:161952248-161952270 GAAAGGGCAAAGATTCAGAATGG - Intronic
941412015 2:165169957-165169979 GAAAAGGGAAGAATGAAGGAAGG + Intronic
941420488 2:165278368-165278390 CAAAAGGCAAAGAGGAGGCAAGG + Intronic
941464780 2:165813149-165813171 GAAAAGGCAATGGGGAAGGAGGG - Intergenic
941528069 2:166630694-166630716 CAAAAGGCAAGGATAAAGAAAGG - Intergenic
941615172 2:167710739-167710761 CAAAAGGAAAAGAGGAACCAAGG - Intergenic
942234185 2:173888524-173888546 CAAAAGGCAAAGAGGAGCCAAGG - Intergenic
943033654 2:182715061-182715083 GAAAACTGGAAGATGAAGCAGGG - Intergenic
943082452 2:183271496-183271518 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
943566059 2:189518059-189518081 GAGAAGGCAAAGATAAAGTTAGG - Intergenic
943990429 2:194682870-194682892 GAAAAGGTAAAGATGGAGAAAGG + Intergenic
944140352 2:196449373-196449395 GAGAAGGTATAAATGAAGCAAGG + Intronic
944223955 2:197330983-197331005 CAGAAGGCAAAGAGAAAGCAAGG + Intergenic
944369072 2:198960661-198960683 CAGAAGGCAAAGGAGAAGCAAGG - Intergenic
944546227 2:200801664-200801686 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
945358015 2:208861350-208861372 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
945424335 2:209681615-209681637 GAAAAGGCAGAGAAGAACTAGGG + Intronic
945565275 2:211390329-211390351 GAAAAGGCAAGAATGAAACAAGG + Intronic
945590287 2:211720571-211720593 AAACAGGCAAAGATCCAGCACGG - Intronic
945922204 2:215766422-215766444 CAAAAGGCAAAAATAAAGAAGGG + Intergenic
946730115 2:222701356-222701378 GGAAAGGAAAAGAGGAAGGAAGG + Intronic
946944292 2:224803633-224803655 TCAAAGGCAATGAGGAAGCATGG - Intronic
946985626 2:225269578-225269600 CAGAAGGCGAAGAGGAAGCAAGG + Intergenic
947236685 2:227948789-227948811 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
947386937 2:229599926-229599948 GAAAAGGAAAGAATGAAGAAGGG + Intronic
947932480 2:233975245-233975267 GTAAATGCATTGATGAAGCACGG + Intronic
1168987907 20:2066180-2066202 AAAAAGGCAAAAGAGAAGCAAGG + Intergenic
1169107875 20:3012594-3012616 GAGAAGGCAAAGATAAAGCATGG + Intronic
1169183708 20:3593923-3593945 GCAAAGGAAAAGGTGAAGCAAGG + Intronic
1169237344 20:3941777-3941799 GAAAATAAAAAGATGAAGCTGGG + Intronic
1169683314 20:8241910-8241932 GTAAAGGCACAGATGAAGACAGG + Intronic
1169770069 20:9190418-9190440 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1169779221 20:9291518-9291540 AAAAAGACAAAGAGGAAGAAAGG + Intronic
1169795079 20:9453440-9453462 GAGAAGGCAATGAAGAAGAAGGG + Exonic
1170311043 20:14991716-14991738 GAAAGGGTAAGGGTGAAGCAAGG + Intronic
1170383525 20:15789104-15789126 GAAAAAGCAAGGATTCAGCAAGG - Intronic
1170445763 20:16425935-16425957 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
1171297008 20:24026154-24026176 GAACAGGGACAGAGGAAGCACGG - Intergenic
1171519024 20:25761489-25761511 GAACAGGCAGAGTTGAAGCTGGG - Intergenic
1171557899 20:26095016-26095038 GAACAGGCAGAGTTGAAGCTGGG + Intergenic
1172756904 20:37291829-37291851 CAAAAGGCAAAGGGGAGGCAAGG - Intronic
1172849625 20:37951845-37951867 GGAAAAGCAAAGATGAATCCAGG - Intergenic
1172909454 20:38395901-38395923 TAGAAGGCAAGGAGGAAGCAAGG + Intergenic
1173098181 20:40058676-40058698 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1173353267 20:42264058-42264080 GAGAAGGCAAGGATGATGCTTGG + Intronic
1173491268 20:43484328-43484350 CAAGAGGCAAAGATGGACCAGGG + Intergenic
1173921071 20:46745535-46745557 GAAACAGCAGAGATGAAGCAGGG + Intergenic
1174196336 20:48775307-48775329 GGAAAGGGAGAGATAAAGCAAGG + Intronic
1174651246 20:52127546-52127568 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1174729667 20:52903405-52903427 GGGAAGGCAAAGAGGAAGCAAGG + Intergenic
1175503088 20:59464062-59464084 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1175629868 20:60526517-60526539 CAGAAGGCAAAGGAGAAGCAAGG + Intergenic
1176065847 20:63194200-63194222 GAAACAACAAAGATAAAGCATGG + Intergenic
1176653172 21:9567892-9567914 GAACAGGCAGAGTTGAAGCTGGG - Intergenic
1176901822 21:14451561-14451583 GAAAAGGTAAAGAGAAATCAAGG - Intergenic
1176913546 21:14597782-14597804 GCAAAGGCACACATGAAGGATGG - Intronic
1177316477 21:19468824-19468846 CGAAAGGCAAAGGGGAAGCAAGG + Intergenic
1177710033 21:24762271-24762293 GAAATGGTTAAGATTAAGCAAGG + Intergenic
1177784277 21:25653527-25653549 TAGAAGGCAAAGGGGAAGCAAGG + Intronic
1177863999 21:26491076-26491098 GAAAAGAAAAATATGAAACATGG + Intronic
1177882954 21:26715973-26715995 GAAATTGCAGAGATGAAGGAGGG + Intergenic
1177906422 21:26976756-26976778 AAGAAGGCCAAGTTGAAGCAAGG - Intergenic
1178024164 21:28446147-28446169 CGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1178246197 21:30955056-30955078 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1178477561 21:32950653-32950675 GAAAATGCACAAATGAAGAAGGG - Intergenic
1178807730 21:35853356-35853378 GATATGGCAAAGATGAAGCATGG - Intronic
1178862012 21:36297503-36297525 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1179055880 21:37933642-37933664 CAAAAGGCAAAGGGGAAGCAAGG - Intergenic
1180743183 22:18067910-18067932 GGAAAAGGAAAGATGGAGCAAGG - Intergenic
1181018335 22:20084443-20084465 GAAAGGGACAACATGAAGCAGGG - Intronic
1181092770 22:20485570-20485592 GAAAAGGCAGAGAAGAGGCCAGG + Intronic
1181882906 22:25995569-25995591 GAAAAGGAAAACAAGAAGCAAGG + Intronic
1182673167 22:32015116-32015138 GAAAAAGCAGAGATGAGGCCGGG + Intergenic
1184320869 22:43741319-43741341 GAAAAGGGGCAGATAAAGCAGGG - Intronic
1184694113 22:46130373-46130395 CAAAGAGCAGAGATGAAGCAGGG + Intergenic
1184780145 22:46644433-46644455 GAAAAGGGACAGATGTAACACGG - Intronic
1184808415 22:46811781-46811803 GAAAAGCCAAAAATGCAGCTGGG + Intronic
1185016918 22:48349658-48349680 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1185234031 22:49700700-49700722 AGAAAGGCAAAGGAGAAGCAAGG - Intergenic
949240020 3:1859703-1859725 CAAAAGGCAAAGGAGAAGCAAGG - Intergenic
949359863 3:3220335-3220357 CAGAAGGCGAAGAGGAAGCAAGG + Intergenic
949585237 3:5430833-5430855 AAGAAGGCAAAGGGGAAGCAAGG + Intergenic
949768368 3:7551921-7551943 CAAATGGCAAAGAGGAAGCAAGG + Intronic
949784355 3:7724207-7724229 GAGAAAGCAACAATGAAGCAAGG + Intronic
949805382 3:7949950-7949972 CAAAAATAAAAGATGAAGCAAGG + Intergenic
950109139 3:10407391-10407413 GAAAAGGAAAGGAAGAAGGAAGG - Intronic
950370644 3:12527033-12527055 GAAGAGGCAAAGATTGGGCAGGG + Intronic
950556137 3:13697177-13697199 GAAAAGGCAAAAAGGGACCAAGG - Intergenic
950913347 3:16617397-16617419 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
950936851 3:16847906-16847928 CAAAAGGAAGAGAAGAAGCAGGG + Intronic
951645121 3:24881162-24881184 CAGAAGGCAAAGGAGAAGCAAGG - Intergenic
952070180 3:29625109-29625131 GTGAAGGCAAAAAGGAAGCAAGG - Intronic
952222154 3:31333820-31333842 GAAAAGTCAAGGATAAAGAAAGG + Intergenic
952691731 3:36215006-36215028 GAAAAGGCACAGATACAGAAGGG - Intergenic
953624687 3:44561222-44561244 CAGAAGGCAAAGAGGAAGGAAGG + Intronic
954238583 3:49275967-49275989 GCAGAGGCAAAGATGAAGCCAGG + Intronic
954505042 3:51062111-51062133 AAAAAGGCAAAGAGGAAGGCAGG - Intronic
955217304 3:56994994-56995016 CAGAAGGCAAAGAGGAGGCATGG - Intronic
955549543 3:60068775-60068797 AAACAGGCAAAGAAGAAACAAGG + Intronic
955586134 3:60480109-60480131 CAGAAGGCAAAGAGAAAGCAAGG + Intronic
955687860 3:61563226-61563248 AAAAGGGCAAAGATGAAGGTAGG - Intronic
955773187 3:62406462-62406484 GAAAAGGCATATCTGAACCAAGG - Intronic
955788659 3:62565969-62565991 GAAAAAACAAAGATGAAGAGAGG - Intronic
956253276 3:67256681-67256703 TAGAAGGCAAAGGGGAAGCAAGG - Intergenic
956354780 3:68378875-68378897 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
956380117 3:68656342-68656364 GAACAGTCAAAAATTAAGCATGG - Intergenic
956587420 3:70879225-70879247 TGAAAGGCAAAGGGGAAGCAGGG - Intergenic
956718242 3:72097126-72097148 GAAAAGGCCTAGAGGAAGTATGG + Intergenic
956811493 3:72867866-72867888 GCAAAGGCACGGATGAAGCTTGG + Intergenic
956856998 3:73284970-73284992 GAAATGGCAAAGATGAAGGGAGG + Intergenic
956969701 3:74508262-74508284 CAGAAGGCAAAGAAGCAGCAAGG - Intronic
957157318 3:76561583-76561605 CAAAAGGCAAAGATAGAACAAGG + Intronic
957256018 3:77838834-77838856 CAGAAGGCAAAGGAGAAGCAAGG - Intergenic
957544864 3:81624121-81624143 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
957555310 3:81759192-81759214 GAAAAGGCCAAGGTAAAGAAGGG + Intronic
957736626 3:84211838-84211860 GAAGAGAAAAAGATGATGCATGG - Intergenic
957793091 3:84963409-84963431 GAAAGGGCAAAAAAGAAACAAGG + Intronic
957946481 3:87069613-87069635 GAATAGTCAGAGATGTAGCAAGG + Intergenic
958185590 3:90115408-90115430 AAAAGGGCAAAGAGAAAGCAAGG - Intergenic
958672311 3:97220525-97220547 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
958688677 3:97432713-97432735 TGTAAGGCAAAGAAGAAGCAAGG + Intronic
959368599 3:105494444-105494466 GAAAGGGAAAAGAAGAAGGAAGG - Intronic
959435465 3:106309925-106309947 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
959629469 3:108491814-108491836 GAAAGGGCAAAGCAGGAGCAGGG - Intronic
959678161 3:109060826-109060848 CAGAAGGCAAAAAGGAAGCAAGG + Intronic
959905742 3:111709526-111709548 GAAAACGAAAAGGTCAAGCATGG + Intronic
959983545 3:112546633-112546655 GGAAAAGCAAGGATAAAGCAAGG + Intronic
960192822 3:114727399-114727421 GAAAAGAAAAAGGTGAACCAAGG - Intronic
960518500 3:118628620-118628642 GAAAAAGGGAAAATGAAGCAAGG + Intergenic
960689251 3:120326922-120326944 GAAAAGGTAAACATTAACCAAGG + Exonic
960766247 3:121133800-121133822 CGCAAGGCAAAGAGGAAGCAAGG + Intronic
961022794 3:123523255-123523277 GAAGAGGGAAAGAGGAAGAAAGG + Intronic
961794598 3:129400756-129400778 GAATAGCCACAGATGCAGCAGGG - Intergenic
961811341 3:129523512-129523534 GAAAAGAGAAAGAGGAAGGAGGG + Intergenic
962612207 3:137087461-137087483 GCGAAGGCAAAGGCGAAGCAAGG - Intergenic
962616735 3:137133999-137134021 GAAAACGCAAGTATGGAGCAGGG + Intergenic
962762782 3:138531681-138531703 AAAAAGGAAAAGAAGAAGGAAGG - Intronic
962888271 3:139648245-139648267 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
963144840 3:141982537-141982559 GAAAAGCCAAGAGTGAAGCAGGG + Intronic
963253656 3:143122643-143122665 GAGAAGGCAAAGAAGAAGAGGGG - Exonic
963255529 3:143140824-143140846 CTGAAGGCAAAGGTGAAGCAAGG - Intergenic
963434311 3:145248804-145248826 CAAAAGTCAAAGATAAAGAAAGG - Intergenic
963522939 3:146378907-146378929 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
963688750 3:148471951-148471973 GAAAAGGCACTGATGCAACAGGG + Intergenic
964002390 3:151790933-151790955 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
964275638 3:155005756-155005778 CAGAAGGCAAAGTGGAAGCAAGG - Intergenic
964275885 3:155008631-155008653 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
964299231 3:155269802-155269824 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
964507625 3:157416762-157416784 GAAAAAGAAAAAATGAAGGAAGG + Intronic
964600198 3:158492064-158492086 CAGAAGGCAAAGGCGAAGCAAGG + Intronic
964632723 3:158830402-158830424 AAGAAGGCAAAGGCGAAGCAAGG - Intergenic
964903212 3:161686170-161686192 GCAAAGGCAAAGGGGAAGCAAGG - Intergenic
965369489 3:167843007-167843029 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
965526927 3:169730600-169730622 CAAAAGCCAAAGATAAAGAAAGG - Intergenic
965588728 3:170342684-170342706 TAAAAGGCAAGGATGCAGCCAGG - Intergenic
965950617 3:174303795-174303817 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
965957485 3:174388866-174388888 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
965960513 3:174423570-174423592 TAGAAGGCAAAGGAGAAGCAAGG + Intergenic
966088306 3:176098430-176098452 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
966248921 3:177839996-177840018 GAGATGGCAAAGAAGAGGCAAGG - Intergenic
966673823 3:182562653-182562675 GGAAAAGCAAAGATGAAATATGG + Intergenic
966799653 3:183750887-183750909 GAAAAGGCAAAAATATAACACGG - Intronic
967015660 3:185479352-185479374 GAAAAGGCAGAGCTGAGGCTTGG - Intronic
967359446 3:188612922-188612944 GAAAAGGAAAAAATGAAGAAAGG + Intronic
967513436 3:190339164-190339186 GAGCAGGAAAAGATGAAGGATGG - Intronic
967523970 3:190470896-190470918 GAACAGGCAGAGACAAAGCAGGG + Intergenic
967732608 3:192919650-192919672 CAAAAAGCAATGATGAAGCAAGG - Intergenic
967805573 3:193711985-193712007 GAGTTGGCAAAAATGAAGCATGG - Intergenic
968125268 3:196154548-196154570 GAAATGCCAAAGATGATTCAAGG - Intergenic
968137716 3:196230988-196231010 GAAAAGGAAAGGAAGAAGCAAGG - Intronic
968530672 4:1089825-1089847 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
969110858 4:4843438-4843460 GTAAAGGAAAAGATGAATGAAGG - Intergenic
969986351 4:11215146-11215168 CAGAAGGCGAAGAGGAAGCAAGG + Intergenic
969996821 4:11321686-11321708 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
970051640 4:11921160-11921182 AAAAAGGCAAAGATGCAGACCGG + Intergenic
970071656 4:12166121-12166143 GAAAAGGGCAAGAAAAAGCAAGG - Intergenic
970087091 4:12361993-12362015 CAGAAGGCAAAGAGCAAGCAAGG + Intergenic
970577578 4:17443241-17443263 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
970639991 4:18053216-18053238 CAAAAGGCAAGGGGGAAGCAAGG - Intergenic
970761687 4:19497141-19497163 TAGAAGGCAAAGGAGAAGCAAGG - Intergenic
970836314 4:20411749-20411771 GAAAAGGCAAAGCTGGAAAAAGG + Intronic
970990687 4:22209720-22209742 GCGAAGGCAAAGGAGAAGCAAGG - Intergenic
971208914 4:24597380-24597402 GAAAAAGAAAAAATGAAGCAGGG - Intergenic
971248711 4:24953375-24953397 GAAAAGACAAAAATGAAGCAGGG - Intronic
971313196 4:25544212-25544234 GAAGAAGCAAAGAAAAAGCATGG - Intergenic
971460290 4:26888919-26888941 GAACAGGCAAAGAAGACCCAGGG - Intronic
971598830 4:28567534-28567556 TGAAAGGCAAAGGGGAAGCAAGG + Intergenic
971677556 4:29653271-29653293 CAGAAGGCAAAGGAGAAGCAGGG + Intergenic
971834451 4:31744670-31744692 AAGAAGGAAAAGATGAAGGAAGG + Intergenic
972033764 4:34494655-34494677 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
972076463 4:35095464-35095486 GAAGAGGCAAAGAAAAAGTAGGG + Intergenic
972374569 4:38458458-38458480 GCAGAGGAAAAGATGAAACAAGG + Intergenic
972496010 4:39635461-39635483 AAAAAGCCAAAGTGGAAGCAGGG + Intronic
972691742 4:41405480-41405502 GACCAAGCAAAGATGAATCAAGG - Intronic
972896421 4:43626606-43626628 GAAAAGGCAAAGAGGCAAAATGG + Intergenic
973003737 4:44985120-44985142 GAAACAGCTATGATGAAGCAGGG - Intergenic
973089368 4:46113285-46113307 GTGAAGGCAAAGGGGAAGCAAGG + Intronic
973832075 4:54771698-54771720 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
973933289 4:55815645-55815667 TGAAAGGCAAAGGGGAAGCAAGG - Intergenic
974078257 4:57187514-57187536 AAATAGGCAAAGATGATTCATGG - Intergenic
974375479 4:61070859-61070881 GAGAAGGTAGAGATGAAGGAAGG + Intergenic
974620560 4:64348212-64348234 CGGAAGGCAAAGACGAAGCAAGG + Intronic
974806246 4:66883739-66883761 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
974835016 4:67237814-67237836 AAAAAGGCAAAGAGGAAAGATGG + Intergenic
975471245 4:74771028-74771050 GAAAAGGCATGGATGAAATAAGG + Intronic
975588049 4:75970848-75970870 GGAAAGGCAAAGGGGAGGCAAGG - Intronic
975724230 4:77276443-77276465 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
975889418 4:79008680-79008702 CAAAAGGCAAATAAGAAACAGGG - Intergenic
975996768 4:80324438-80324460 GAAAAGGGGAAAATTAAGCATGG + Intronic
976053978 4:81041368-81041390 GAGAAGGCAAAAATAAAGTATGG + Intronic
976437252 4:85032441-85032463 CAAAATGCACAAATGAAGCAAGG + Intergenic
976554579 4:86435199-86435221 AAAATGGCAAAGATGAGGCCAGG + Intronic
976640312 4:87330896-87330918 TAGAAGGCAAAGGGGAAGCAAGG + Intergenic
976645017 4:87378269-87378291 TAATAGGCAATGATGAAGAAAGG - Intronic
976886272 4:89988508-89988530 AAAAGGTCAAGGATGAAGCAAGG - Intergenic
977016238 4:91695887-91695909 CAGAAGGCAAAGAGGAAGCAGGG + Intergenic
977064066 4:92291210-92291232 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
977122834 4:93125770-93125792 GAAAAGTGAAAGATGAAGGGTGG + Intronic
977182627 4:93896044-93896066 AAAAAGTCAAAGATGACTCAAGG + Intergenic
977393018 4:96437392-96437414 TAGAAGGCAAAGAGGAAGCAAGG + Intergenic
977646160 4:99415178-99415200 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
977745403 4:100541213-100541235 GTATAGGAAAAGATGAAGAAAGG + Intronic
978023337 4:103841006-103841028 CAGAAGGCAAAGGAGAAGCAAGG - Intergenic
978121947 4:105090625-105090647 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
978212495 4:106155279-106155301 GAAAGGTCAAAGATAAAGAAAGG - Intronic
978667249 4:111199091-111199113 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
978891871 4:113839044-113839066 TAAAAGGCAAAGATGCTCCAGGG - Intergenic
979044689 4:115848242-115848264 AAAATGGCAAACATGAAGCATGG - Intergenic
979121906 4:116913984-116914006 GGAAAGGCAAAGGGGAAGCAAGG - Intergenic
979268028 4:118726031-118726053 GAGAAGGCACACAAGAAGCAAGG - Intronic
979268441 4:118731559-118731581 GGAAAGGAAAAGAGGAAGGAGGG - Intronic
979399691 4:120233367-120233389 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
979404584 4:120293876-120293898 CATAAGGCAAAGAAGAGGCAAGG + Intergenic
980080745 4:128341336-128341358 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
980188867 4:129497083-129497105 GCAAAGGAAAAGATGGAGCATGG - Intergenic
980460636 4:133106911-133106933 TGAAAGGCAAAGGGGAAGCAAGG - Intergenic
980499573 4:133630946-133630968 GAAAAGGCAAAGATGTAGACTGG + Intergenic
980841015 4:138261526-138261548 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
980882568 4:138727593-138727615 GAAAGGATGAAGATGAAGCAAGG - Intergenic
980938383 4:139248285-139248307 GAAAAGGCCAAGAGGCAGAAAGG + Intergenic
981392152 4:144203627-144203649 GGAATGGCAAGGATGAGGCAAGG + Intergenic
981495754 4:145390532-145390554 GAAAAGGGAAGGATGGAGAAGGG + Intergenic
981696633 4:147565300-147565322 CAAAACGCACAAATGAAGCATGG + Intergenic
981768056 4:148274578-148274600 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
981864355 4:149397544-149397566 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
982319735 4:154065686-154065708 CAAAAGTCAAAGACAAAGCAAGG - Intergenic
982557640 4:156888643-156888665 AAAAACACAAAGATTAAGCAAGG - Intronic
982899343 4:160979287-160979309 CAAAAGTCAAGGATGAAGAAAGG - Intergenic
983089654 4:163488336-163488358 CAGAAGGCAAAGGAGAAGCAAGG + Intergenic
983487587 4:168350436-168350458 AAGAAGGCAAAGAGGAATCAAGG - Intergenic
984050737 4:174861907-174861929 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
984334360 4:178369909-178369931 CAAAAGGCAAAGGGGAAGCAAGG + Intergenic
984431208 4:179651296-179651318 AAACAGGCAGAAATGAAGCAAGG - Intergenic
984453323 4:179931679-179931701 TAGAAGGCAAAGGAGAAGCAGGG - Intergenic
984764708 4:183391118-183391140 GAAAAGACAAAGAAAAAGAAAGG - Intergenic
984803294 4:183733768-183733790 GAAAGGGGAAGGAGGAAGCAGGG - Intergenic
984807082 4:183761505-183761527 GAAAGGGCAAAGAGGAACCGAGG - Intergenic
986399300 5:7364570-7364592 GGAAAGGGAAAAATCAAGCAGGG + Intergenic
986625371 5:9718896-9718918 TAAAAGGCAAAGAAAAATCATGG + Intergenic
986723034 5:10573651-10573673 CAAAAGGCAAAGGGGAAGCAAGG + Intronic
986991965 5:13564714-13564736 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
987014226 5:13801028-13801050 GAAAAGTCAAAGATGACTCCAGG - Intronic
987289424 5:16494584-16494606 CAGAAGGCAAAGAAGAAGCAAGG - Intronic
987396739 5:17431559-17431581 GAAAATGGAAAGAGGAAGAAAGG - Intergenic
987480655 5:18453067-18453089 AAAAAGAGAAAAATGAAGCAAGG + Intergenic
987499067 5:18682288-18682310 CAAAAGGCAAAGGGGAAGCGAGG - Intergenic
987539019 5:19229502-19229524 GAAAAGGTAAAGATAAGGAAAGG - Intergenic
987550070 5:19368090-19368112 AAAAATGCAAGGATGAAGAAGGG + Intergenic
987843224 5:23247325-23247347 CAGAAGGCGAAGAGGAAGCAAGG - Intergenic
987868356 5:23575795-23575817 GAAAAGGCAAAAACCAAGCAAGG - Intergenic
987893924 5:23919784-23919806 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
987984018 5:25122752-25122774 CAAAAGGTAAAGGGGAAGCAAGG + Intergenic
988230169 5:28466425-28466447 TAGAAGGCAAAGAGGAAGCAAGG - Intergenic
988252628 5:28780094-28780116 GAAAAGACAGAGAAGAAGGAAGG - Intergenic
988550473 5:32196559-32196581 AAAAATGCAAAGATGAGCCAGGG - Intergenic
988628414 5:32901726-32901748 TGGAAGGCAAAGAGGAAGCAAGG + Intergenic
989011000 5:36872807-36872829 GAATAGGCCAAGATGAAAAAAGG + Intergenic
989019235 5:36981697-36981719 AAATAGGCAAAGATGAACAAAGG - Intronic
989093164 5:37755623-37755645 AAACAGGCAAGGATGAAGAATGG + Intergenic
989289484 5:39746879-39746901 TAGAAGGCAAAGGGGAAGCAAGG - Intergenic
989451307 5:41589263-41589285 GAAAAGGCAAAAAAGAAGCATGG - Intergenic
989817075 5:45749843-45749865 TGGAAGGCAAAGAAGAAGCAAGG + Intergenic
990010188 5:50988286-50988308 GAAAAAGAAAAGAGGAAGGAAGG - Intergenic
990124002 5:52491998-52492020 GCAAAGGCAAACATGGAGAAAGG + Intergenic
990266426 5:54081671-54081693 CAGAAGGCGAAGAGGAAGCAAGG - Intronic
990484107 5:56241314-56241336 TAGAAGGCAAAGGGGAAGCAAGG - Intergenic
990484452 5:56243868-56243890 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
990623636 5:57587522-57587544 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
990839133 5:60055922-60055944 CAAAAGGGAAAGGAGAAGCAAGG + Intronic
991121892 5:63026134-63026156 GAAAAGGAAAAGCTGAGGAAGGG + Intergenic
991226856 5:64283700-64283722 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
991263059 5:64687321-64687343 GAAGAGGCCACGAGGAAGCAGGG - Intergenic
991348933 5:65700707-65700729 GAAAAGAAAAAGAAGAATCATGG + Intronic
991389210 5:66124513-66124535 GAATAGTCAAAGATGAAGAAAGG + Intergenic
991559141 5:67930663-67930685 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
991600242 5:68344721-68344743 GAAAAGATAAAGGAGAAGCATGG + Intergenic
992037814 5:72798301-72798323 GAAAAGGCAGAGATGCAGGGTGG + Intergenic
992282983 5:75201190-75201212 TAAATTGCAAAGATGAAGCGAGG - Intronic
992742863 5:79791423-79791445 GAAAAGGCATAGAAGAGGCTGGG + Intronic
993039196 5:82793054-82793076 CAGAACGCAAAGAGGAAGCAAGG - Intergenic
993048237 5:82893526-82893548 GAACACGCATGGATGAAGCAAGG + Intergenic
993303443 5:86243458-86243480 AAAAAGCCAAATGTGAAGCAAGG + Intergenic
993676869 5:90825986-90826008 TAAAAGGCAAGGAACAAGCAAGG + Intronic
993687303 5:90954525-90954547 GAAAAGGTAAAGATGTTGAAAGG - Intronic
994457089 5:100024715-100024737 GCAAAGGAAAAAATAAAGCAGGG + Intergenic
994747495 5:103696890-103696912 CAAGAGGCAAAGATGAAGTGGGG - Intergenic
994876467 5:105429086-105429108 GAACAAGCAAGGATGAAGGAAGG - Intergenic
994932837 5:106211088-106211110 GAAGAGGCAAAGATCAAGTAAGG + Intergenic
994992182 5:107010948-107010970 TGGAAGGCAAAGAGGAAGCAAGG + Intergenic
995206880 5:109489911-109489933 TAAAAGGCAAAGAGAAAGGATGG - Intergenic
995261636 5:110110908-110110930 GCAAAGGAAAAGAGGAAGAAGGG - Intergenic
995286608 5:110396116-110396138 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
995288715 5:110423666-110423688 AAAAAGGAAAAGATGATGGATGG + Intronic
995304908 5:110633653-110633675 CAAAAGGTGAAGAAGAAGCAAGG - Intronic
995353907 5:111215130-111215152 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
995683988 5:114750952-114750974 AAAAGGGAAAAGATCAAGCATGG - Intergenic
995746501 5:115409381-115409403 GAAGAAACAAAGAGGAAGCAAGG + Intergenic
995927990 5:117398903-117398925 CTAAAGGCATGGATGAAGCAGGG - Intergenic
995988839 5:118210819-118210841 CAAAAGACAAAGGGGAAGCAAGG - Intergenic
996123189 5:119694464-119694486 TGAAAGGCAAAGGGGAAGCAAGG + Intergenic
996152143 5:120052225-120052247 GAACTGGCAAAGATGAAGAACGG - Intergenic
996435141 5:123425626-123425648 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
996502226 5:124230048-124230070 GAAAAGGCAACATTGGAGCAGGG - Intergenic
996597028 5:125216374-125216396 AGACAGACAAAGATGAAGCAGGG + Intergenic
996605373 5:125314618-125314640 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
996616247 5:125444628-125444650 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
997007553 5:129836474-129836496 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
998263853 5:140652136-140652158 GAAAAAGAAAAGGTGAAGGAAGG + Exonic
998435064 5:142101094-142101116 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
998577229 5:143329172-143329194 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
999065649 5:148683075-148683097 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
999418039 5:151416992-151417014 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
999969415 5:156844418-156844440 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1000006871 5:157193733-157193755 GAAAAGGCAGAGTTGGGGCAAGG + Intronic
1000111715 5:158114380-158114402 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1000471512 5:161648219-161648241 GAAAAGGCATAGAAGAACCTTGG - Intronic
1000560122 5:162776944-162776966 GCAAAGGCGAAGGGGAAGCAAGG - Intergenic
1000660281 5:163929908-163929930 TGAAAGGCAAAGGGGAAGCAAGG - Intergenic
1000686394 5:164254975-164254997 CGAAAAGCAAAGAGGAAGCAAGG - Intergenic
1001393813 5:171402819-171402841 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1003402880 6:5805433-5805455 CAGAAGGCAAAGAGGAAGCAGGG - Intergenic
1004320801 6:14630151-14630173 GAATAGGAGAAGATGAATCAGGG - Intergenic
1004330238 6:14714475-14714497 GAAAAGGAAGAGAGGAAGGAAGG - Intergenic
1004523996 6:16388996-16389018 GAAAAGACAAGGATGATGGATGG - Intronic
1004833390 6:19502071-19502093 GAAAAGTCGAAGATGAACAATGG - Intergenic
1005784243 6:29226722-29226744 GAGAAGGGAAATATGAAGCAAGG - Intergenic
1006370895 6:33643055-33643077 GAAAAGACAAAGATGGAGCTTGG + Intronic
1006905913 6:37533520-37533542 GAAAAGGCTAAGGCTAAGCAGGG - Intergenic
1006972210 6:38057962-38057984 GAAAAGGCATAGAAGGAGTATGG + Intronic
1006988168 6:38190871-38190893 GAAAAGGCTAAGAAGCAGCAAGG - Intronic
1007009481 6:38401292-38401314 CAGAAGGCAAAGAGGAAGCAAGG - Intronic
1007232141 6:40355831-40355853 GGAAAGGAAAAGAAGGAGCAAGG - Intergenic
1007239646 6:40415807-40415829 GTAAAGGCAAGGATGGAGGAAGG + Intronic
1007317250 6:40999248-40999270 AAACAGGCAAAGATGGCGCACGG + Intergenic
1007464279 6:42041162-42041184 GGAAAGGCAGAGAAGAAACAGGG + Intronic
1007932158 6:45701304-45701326 GAAAATGTAAAGATGAACAAAGG - Intergenic
1008048848 6:46879512-46879534 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1008547413 6:52595589-52595611 GGTAAGGCAAAGATGAAAGAAGG + Intergenic
1008607002 6:53150283-53150305 AAAAAAAAAAAGATGAAGCAGGG - Intergenic
1009714993 6:67379840-67379862 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1010192695 6:73209911-73209933 GAGAAGACAAGGATGAAGGAGGG + Exonic
1010196236 6:73242361-73242383 GAGAAGACAAGGATGAAGAAGGG + Intronic
1010340983 6:74752340-74752362 CAAAAGGCGAAGCAGAAGCAAGG + Intergenic
1010366490 6:75058129-75058151 CAGAAGGCAAGGAGGAAGCAAGG + Intergenic
1010688124 6:78876250-78876272 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1011121728 6:83961547-83961569 TAGAAAGCAAAGAAGAAGCAAGG - Exonic
1011385651 6:86795546-86795568 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1011448391 6:87467481-87467503 GAAAGGGCAAACTGGAAGCAGGG + Intronic
1011498872 6:87966076-87966098 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1011701045 6:89955127-89955149 GATAAGGAAACTATGAAGCAGGG + Intronic
1011844524 6:91546889-91546911 TAAAAGGCAAAAATGAAGAATGG + Intergenic
1011956048 6:93026612-93026634 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1012003154 6:93680096-93680118 GAAAAGAAAAACATGAAGCAAGG - Intergenic
1012039215 6:94183922-94183944 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1012274878 6:97260983-97261005 TAGAAGGCAAAAATGAATCATGG - Intronic
1012327803 6:97945229-97945251 AAAAAAGCAAAAGTGAAGCAGGG + Intergenic
1012798598 6:103795997-103796019 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1012849890 6:104433970-104433992 GAAAATGCTAAAATGAAGAATGG + Intergenic
1012865299 6:104611427-104611449 AGAAAGGCAAAGGGGAAGCAAGG + Intergenic
1012880276 6:104779176-104779198 GAAAAGTCAAAGGAGAAGCAAGG + Intronic
1012958909 6:105601581-105601603 GAAGAGGCAAAGAGAATGCAAGG - Intergenic
1013325205 6:109038878-109038900 GAAGAGGAAAAGAAGAAGGAAGG + Intronic
1013418933 6:109948970-109948992 GGAAAGGAACAGATGAGGCAGGG + Intergenic
1013721849 6:113039854-113039876 TAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1013773570 6:113653382-113653404 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1013812406 6:114059688-114059710 CAGAAGGCAAAGAAGAAGCAAGG - Intronic
1013904287 6:115197580-115197602 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1013928419 6:115501464-115501486 CAGAAGGCAAAGGAGAAGCAAGG + Intergenic
1013930525 6:115525830-115525852 GAAAAGGAAAATATGTAGGAAGG + Intergenic
1013955541 6:115836369-115836391 GAAACGGCAAAGGTGAAAAATGG + Intergenic
1014815561 6:125931934-125931956 CAGAAGGCAAAGGGGAAGCAAGG - Exonic
1014835080 6:126151788-126151810 GAAAAGACAGAGAGGAAGGAAGG - Intergenic
1014992907 6:128103804-128103826 GACAGGTCAAAGAGGAAGCAGGG - Intronic
1015246566 6:131081195-131081217 GAAAAGGAAAAGAAAAAGAAAGG + Intergenic
1015665588 6:135624941-135624963 TTAAAGGCAAAGAAGAAACATGG - Intergenic
1015979541 6:138825229-138825251 GAGCAGGCAAAGAAGAACCAAGG - Intronic
1016077310 6:139811656-139811678 GAATGAGCAAAGATGAAGAAAGG - Intergenic
1016133720 6:140511350-140511372 GAAAAGGAAAAAATGAATAAAGG - Intergenic
1016544228 6:145202520-145202542 GAAAATGGAAAGAGGAAGCATGG + Intergenic
1016557498 6:145354851-145354873 CACAAGGCAAACATGAAGCGGGG - Intergenic
1016632417 6:146248515-146248537 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1016632698 6:146250498-146250520 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
1016708466 6:147141766-147141788 AAGAAGGTGAAGATGAAGCAAGG + Intergenic
1016831480 6:148438041-148438063 GAAAAGGTAAAAATGGAGGAGGG + Intronic
1016980758 6:149851910-149851932 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1017338853 6:153296148-153296170 CAAAAAGAAAAGAAGAAGCATGG + Intergenic
1018779554 6:167050249-167050271 CAGAAGGCAAAGGAGAAGCAAGG - Exonic
1018792440 6:167158866-167158888 GAAAAGATCAAGATGAAGTAGGG - Intronic
1019981080 7:4622710-4622732 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1020904477 7:14048259-14048281 CAAAAGGCAAAGGGGAAGCAAGG - Intergenic
1021206769 7:17789870-17789892 GAAAAGGGAAAGATGGAAAAAGG - Intergenic
1021338982 7:19439784-19439806 CAAAAGGCAAAGAGGAAGCAGGG - Intergenic
1021526838 7:21597532-21597554 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1021725899 7:23547920-23547942 GAAAAGGCAAGAAGGAAGGAAGG - Intergenic
1021771840 7:24010909-24010931 GAATAGGCAAAGACGAAGACAGG - Intergenic
1022352164 7:29576595-29576617 CAAAAGGCAAAAAGGAAGCAAGG - Intergenic
1022352443 7:29578513-29578535 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1022758749 7:33324903-33324925 CAAAAGGCAAGGATAAAGAAAGG - Intronic
1023041468 7:36176359-36176381 GAAGAAGCAAAGAAGAGGCAGGG + Intronic
1023188718 7:37556862-37556884 TAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1023802633 7:43848205-43848227 TAAAGGGAACAGATGAAGCAGGG + Intergenic
1024011766 7:45272891-45272913 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1024311433 7:47973109-47973131 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1025279519 7:57616622-57616644 GAACAGGCAGAGTTGAAGCTGGG - Intergenic
1025290309 7:57714362-57714384 CAAAAGGTAAAGGAGAAGCAAGG + Intergenic
1025305212 7:57848878-57848900 GAACAGGCAGAGTTGAAGCTGGG + Intergenic
1025917771 7:65879789-65879811 GAAAAGGAAAGAAGGAAGCAAGG - Intronic
1026092216 7:67309728-67309750 AAAAAGGGAAGGAAGAAGCAGGG - Intergenic
1026375111 7:69742213-69742235 GAAAAGTCAAACCTGAAGGAAGG - Intronic
1026621032 7:71950106-71950128 CAAAATGCACAAATGAAGCAAGG - Intronic
1026993824 7:74603138-74603160 GAAAATGCAAAAATGAGGCCGGG + Intergenic
1027481656 7:78705323-78705345 CACAAGGCAAAGAGGAAACAAGG - Intronic
1027507825 7:79040249-79040271 CAGAAGGCAAAGGGGAAGCATGG - Intronic
1027659071 7:80967229-80967251 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1028653197 7:93173559-93173581 CAAAAGGCAAAGGGGAAGCAAGG - Intergenic
1029061166 7:97799265-97799287 GAAAAGGCAAAGTTTGTGCAAGG + Intergenic
1029377648 7:100189609-100189631 AAAAAGGGAAGGAAGAAGCAGGG - Intronic
1029915049 7:104200028-104200050 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1030349711 7:108469998-108470020 AAAAAGGCAAAGAGGAGGAATGG - Intergenic
1030492375 7:110254148-110254170 GAAAAGGCAGAAATGAGGCATGG - Intergenic
1030611365 7:111693142-111693164 TGGAAGGCAAAGAGGAAGCAAGG + Intergenic
1030619658 7:111775150-111775172 GAAAAGTCAAAGATACATCAGGG + Intronic
1030629510 7:111880147-111880169 GAAAGGTCAAGGATGAAGAAAGG + Intronic
1030685070 7:112477541-112477563 GAATAGGAAAGGATGGAGCAAGG - Intronic
1030703981 7:112672136-112672158 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1030758725 7:113323591-113323613 CAAAAAGCAAAGAAGAAGCATGG - Intergenic
1030764294 7:113389871-113389893 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1030783701 7:113633854-113633876 CAAAAGGCAAAGGGTAAGCAAGG + Intergenic
1031255084 7:119436577-119436599 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1031373294 7:120994295-120994317 GAAAGGGTAGAGAGGAAGCAAGG - Intronic
1031567831 7:123321733-123321755 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1031642020 7:124176197-124176219 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1031730316 7:125292311-125292333 GAAAAGACAAATACCAAGCAAGG - Intergenic
1031779975 7:125948567-125948589 GAAAAGGAGAAGATCCAGCATGG + Intergenic
1031785358 7:126024219-126024241 CGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1031806946 7:126318110-126318132 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1031903382 7:127434546-127434568 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1032495690 7:132360394-132360416 GGATAGGCAAAGATGATGCCTGG - Intronic
1032987600 7:137356230-137356252 TAGAAGGAAAAGATGAAGCCTGG + Intergenic
1033021045 7:137724597-137724619 GAAAAGCCAAGGATGACTCAAGG + Intronic
1033716917 7:144011650-144011672 AAAAAGGTGAAGAAGAAGCAAGG - Intergenic
1033804138 7:144935747-144935769 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1033843318 7:145401976-145401998 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1033910841 7:146261112-146261134 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1034000031 7:147401799-147401821 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1034689136 7:152999990-153000012 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1034738834 7:153454495-153454517 GAAGAGGCAAAGCGGATGCATGG - Intergenic
1034951603 7:155300628-155300650 AAAATGGCAAAGATGAAGGCAGG - Intronic
1035120594 7:156563615-156563637 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1035608522 8:945538-945560 GAAGAGACAAAGATGGGGCAGGG - Intergenic
1036029461 8:4951495-4951517 GGAAAGGGAAAGAGGAAGGATGG + Intronic
1036289127 8:7471827-7471849 GAAAAGGAACAGATGCAACAGGG - Intronic
1036332348 8:7839700-7839722 GAAAAGGAACAGATGCAACAGGG + Intronic
1036565964 8:9938306-9938328 GCAAGGTCAAAGATGGAGCATGG - Intergenic
1036805008 8:11825199-11825221 GAGAAGGCAACGATGAAAGATGG - Intronic
1037568835 8:20141553-20141575 AAAAAGGGGAAGAAGAAGCAGGG + Intergenic
1037680679 8:21095040-21095062 GGAGAGGGAAAGATGAAGGAAGG + Intergenic
1038410865 8:27358704-27358726 GAAAAGGCAAAGATGAAGCATGG - Intronic
1038529872 8:28309825-28309847 GGATAGGCAGAGATGAAGAAAGG - Intergenic
1038575078 8:28698199-28698221 GAGAAGTCAAAGATGATGCCAGG + Intronic
1038662062 8:29506026-29506048 GAGAAGACAAGGATGATGCATGG - Intergenic
1038707425 8:29907723-29907745 GAAAAGCAAAACAGGAAGCAGGG - Intergenic
1038713646 8:29972465-29972487 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1038812487 8:30863629-30863651 GAAAAGAAAAAAATGAAGAAGGG - Intronic
1038865532 8:31435237-31435259 GCAAAGGGAAAAATTAAGCAGGG + Intergenic
1039000379 8:32973219-32973241 CAGAAAGCAAAGGTGAAGCAAGG - Intergenic
1039113433 8:34065317-34065339 GAAAAGGGAAATATGCACCAAGG - Intergenic
1040486489 8:47877471-47877493 TAAAAGGCCAAGATGAAGCTTGG + Intronic
1040798038 8:51308552-51308574 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1041309908 8:56505771-56505793 GTAAAGCCAGAGATGTAGCAAGG - Intergenic
1041687373 8:60656898-60656920 GCAAAGGCAGAGATGCAGAAAGG + Intergenic
1041780884 8:61577645-61577667 CAGAAGGCAAAGAGGAATCAAGG + Intronic
1042421126 8:68590249-68590271 GAAAAGCAAAAGATGGAGGAAGG + Intronic
1042550621 8:69991217-69991239 GAGAAGTCATGGATGAAGCAAGG + Intergenic
1042572027 8:70176394-70176416 GCAAAGCCAGAAATGAAGCAAGG - Intronic
1043198909 8:77338296-77338318 CAGAAGACAAAGAGGAAGCAAGG - Intergenic
1043209368 8:77491701-77491723 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1043545586 8:81312162-81312184 CAAAGTGCAAAAATGAAGCAGGG + Intergenic
1043599080 8:81917149-81917171 AAAAAGGTAAGGATGAATCAGGG - Intergenic
1043626757 8:82271396-82271418 TAAGAGGCACAGGTGAAGCAAGG + Intergenic
1043627575 8:82281890-82281912 GGGAAGTCCAAGATGAAGCAAGG + Intergenic
1043875091 8:85476865-85476887 TAAAAGGCCAAGATGAAAAATGG + Intronic
1043883493 8:85571594-85571616 GAAAAAGAAATGATGAATCATGG - Intergenic
1044055817 8:87568811-87568833 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1044186273 8:89255380-89255402 GGGAAGGCAAAGGGGAAGCAAGG + Intergenic
1044187323 8:89269974-89269996 GATAAGGTAAAGATGAATGAGGG + Intergenic
1044299947 8:90572327-90572349 GAAAAGGGAAGGAAGAAGCCTGG - Intergenic
1044614830 8:94129252-94129274 GAAAAGGCACAGAGGCAGAAGGG + Intronic
1044980718 8:97713725-97713747 AAAAAGAAAAAGAAGAAGCAAGG + Exonic
1045147801 8:99367422-99367444 TAAAAGTCAAGGATGAAGAAAGG - Intronic
1045404894 8:101856069-101856091 GAAGAGGAAAAGATGAAGAATGG + Intronic
1045869968 8:106915162-106915184 GAGAAGGCAAAGAAAATGCAGGG - Intergenic
1046061813 8:109149316-109149338 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1046178111 8:110606084-110606106 CAGAAGGCAAAGGTGAAGCAAGG - Intergenic
1046336922 8:112802761-112802783 AAAAAAGCAAAGATCAAGAAGGG - Intronic
1046520985 8:115325651-115325673 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1046531982 8:115458025-115458047 GAAAAGGCCAAAATGAGGGAGGG + Intronic
1046611204 8:116427631-116427653 GAAAAGGCAGCAATAAAGCAAGG + Intergenic
1046735345 8:117770507-117770529 AAGAAAGCAAAGATGAAGGAAGG - Intergenic
1046849895 8:118960265-118960287 GAAAGGGCTAAGAAAAAGCATGG + Intergenic
1046984530 8:120372634-120372656 GAAAAGGCTAACACGAAGGATGG + Intergenic
1047145735 8:122197205-122197227 CAAAAGGCAGAGAGGAAACAGGG + Intergenic
1047650882 8:126919015-126919037 GAAAAGGCAAATTAAAAGCATGG - Intergenic
1047691584 8:127360337-127360359 CAGAAGGCAAAGGGGAAGCAGGG + Intergenic
1048054142 8:130847265-130847287 GAAAAGGGAAAGAAGAAGAAAGG + Intronic
1048367755 8:133753291-133753313 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1048388215 8:133933581-133933603 TAGAAGGCAAAGGAGAAGCAAGG + Intergenic
1048777834 8:137967214-137967236 GAATGTGCAAAGATGAGGCAAGG - Intergenic
1049893958 9:96705-96727 GCAAAGGCCATGATGAAGAAGGG + Intergenic
1050119910 9:2297661-2297683 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1050333147 9:4565467-4565489 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1050536906 9:6638508-6638530 AAAGAAGCAAAGATGAAGCTGGG - Intronic
1050565161 9:6874756-6874778 GAGAAGGCAAGGATGAAGCATGG + Intronic
1050778459 9:9299239-9299261 GAAAAAGCAAATATGCAGAAAGG + Intronic
1050790477 9:9462659-9462681 GAAAAGGAAAAGTTAAAGAAGGG - Intronic
1051255309 9:15207068-15207090 CAGGAGGCAAAGAGGAAGCAAGG - Intronic
1051430091 9:16972811-16972833 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1051775317 9:20625774-20625796 GAAAAGAGGAAGAAGAAGCATGG + Intergenic
1051926034 9:22327163-22327185 GAATAGGAAAAGAAGAAGAATGG + Intergenic
1051936519 9:22447956-22447978 GATAATGAAAAAATGAAGCATGG + Intronic
1052133374 9:24879403-24879425 GAAAAGAGAAAAATGAAGCAGGG - Intergenic
1052400416 9:27993210-27993232 GAAAAGGCAAAGAAAAAGAGGGG - Intronic
1052495650 9:29220296-29220318 GAAAAGGGAAATTTGAACCAAGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053650676 9:40165700-40165722 GAAAAAGCAAGGAAGAAGAATGG - Intergenic
1053735187 9:41096789-41096811 GCAAAGGCCATGATGAAGAAGGG + Intergenic
1053755061 9:41298223-41298245 GAAAAAGCAAGGAAGAAGAATGG + Intergenic
1054331185 9:63757472-63757494 GAAAAAGCAAGGAAGAAGAATGG - Intergenic
1054533906 9:66210502-66210524 GAAAAAGCAAGGAAGAAGAATGG + Intergenic
1054693195 9:68334608-68334630 GCAAAGGCCATGATGAAGAAGGG - Intronic
1054735064 9:68742740-68742762 GAAACAGCAAAGATCCAGCATGG - Intronic
1054846592 9:69805288-69805310 GAAAAGGCAAGGAGGCAGGAAGG - Intergenic
1054874150 9:70077718-70077740 GAACATCCAAAGAGGAAGCAAGG - Intronic
1054882091 9:70154882-70154904 GAAAAGGCACAGTTTAAGAATGG - Intronic
1055322049 9:75091710-75091732 GAAAAAGTAAAGATAAAGCATGG + Intronic
1055383938 9:75740725-75740747 GAAAAGGAAAAAAAAAAGCAAGG + Intergenic
1055535217 9:77234950-77234972 GATAACGTAAAGATGAAGAATGG - Intronic
1055574324 9:77647099-77647121 GAAAAGGCAAAGCCGATGCTAGG - Intronic
1055698518 9:78916227-78916249 TAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1055851844 9:80641307-80641329 GAAATGGGAAATATGAATCAAGG + Intergenic
1056192531 9:84198555-84198577 CCAAAGGCAAAGGTGTAGCAAGG + Intergenic
1056401277 9:86229898-86229920 GGGAAGGCAAAGGAGAAGCAGGG + Intronic
1056435840 9:86575512-86575534 CAGAAAGCAAAGAAGAAGCAAGG + Intergenic
1056455876 9:86759339-86759361 GAAAAGGAAAAAAGGAAGGAAGG + Intergenic
1056482946 9:87024262-87024284 CAGAAGGCAAAGGAGAAGCAAGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056707406 9:88963543-88963565 CAAAAGGCAAAGGGGAAGCAAGG - Intergenic
1057233174 9:93337538-93337560 GCAAAAGCAAAGGAGAAGCAAGG - Intronic
1057233450 9:93339534-93339556 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1057541043 9:95970577-95970599 GAGAAGGCCAAGTAGAAGCAGGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057978660 9:99635191-99635213 CCCAAAGCAAAGATGAAGCAAGG - Intergenic
1058288699 9:103210968-103210990 CTAAAGGCAAAGGGGAAGCAAGG + Intergenic
1058338063 9:103857926-103857948 AAAATGGCAAAGATGAAGAATGG - Intergenic
1058397716 9:104574169-104574191 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1058555327 9:106160525-106160547 GAAGAGGAACAGATGGAGCAGGG + Intergenic
1058588137 9:106532352-106532374 GAGAAGGCACAGATGTGGCAAGG - Intergenic
1058805717 9:108589490-108589512 GAAAATGTAAAGATGGAGAAGGG + Intergenic
1059418390 9:114175817-114175839 GAGAAGGCAAAGACCCAGCAGGG - Intronic
1059565075 9:115376079-115376101 TAGAAGGCAAAGGGGAAGCAAGG + Intronic
1059719517 9:116945962-116945984 CAAAAGGCAAAGGGGAAGCAAGG + Intronic
1061105274 9:128525339-128525361 CAAGAGGCACAGATGCAGCAGGG + Exonic
1061429469 9:130522217-130522239 CAGAAGGCAAAGAGGAAGAAAGG + Intergenic
1061752625 9:132791179-132791201 CAAAAGGTAAAGGGGAAGCAAGG + Intronic
1062103905 9:134742317-134742339 GAAAAGGCACAGACCAGGCACGG + Intronic
1202798561 9_KI270719v1_random:150391-150413 GAAAAAGCAAGGAAGAAGAATGG - Intergenic
1203630903 Un_KI270750v1:71432-71454 GAACAGGCAGAGTTGAAGCTGGG - Intergenic
1186269154 X:7866347-7866369 GGAAAGGAAAAGAAGAAGGAAGG - Intergenic
1186346967 X:8703595-8703617 GAAAAGCCACAGGTGAAGAAAGG + Intronic
1187082267 X:16003249-16003271 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1187323995 X:18269409-18269431 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
1187437434 X:19285514-19285536 CAGAAGGCGAAGAGGAAGCAAGG - Intergenic
1187475957 X:19611210-19611232 CATAAGACTAAGATGAAGCATGG - Intronic
1187574636 X:20541464-20541486 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1187749381 X:22445175-22445197 GATAAGGGAAGGATGAAGCATGG + Intergenic
1187807459 X:23136614-23136636 CAAAAGGCCTAGGTGAAGCAGGG + Intergenic
1188018897 X:25135413-25135435 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1188115186 X:26233733-26233755 GAATAGGCAAACAAAAAGCATGG - Intergenic
1188216677 X:27487440-27487462 AAAAAGACAAAAATGTAGCAGGG - Intergenic
1188283603 X:28300899-28300921 AAGAAGGCCAAGAGGAAGCAAGG - Intergenic
1188631280 X:32364447-32364469 AAAAAGGGAAAGATAAAGGAAGG + Intronic
1188855097 X:35184852-35184874 GAAAAGGCAATGCAAAAGCAGGG - Intergenic
1189017220 X:37296809-37296831 CAGAAGGCAAAGAGGGAGCAAGG + Intergenic
1189192652 X:39123744-39123766 GAAAAGGTAGAGATTGAGCATGG - Intergenic
1189224159 X:39398598-39398620 GAAAAGGAAAAGAGGGAGGAAGG - Intergenic
1189229714 X:39442814-39442836 GAAAAGGAGAAGAGGAAGCGAGG + Intergenic
1189347451 X:40252706-40252728 AAAAAGGAAAACATGAAGAATGG - Intergenic
1189411726 X:40778809-40778831 CAAAAGGCGAAGGGGAAGCAAGG - Intergenic
1189730106 X:44011250-44011272 GAGAAGGTGAATATGAAGCAAGG - Intergenic
1189730401 X:44014275-44014297 CAGAAGGCAAAGGAGAAGCAAGG - Intergenic
1189903485 X:45733647-45733669 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1190122837 X:47676711-47676733 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1190167698 X:48086741-48086763 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1190228873 X:48566063-48566085 AAAAACGAAAAGATGAAGAAAGG + Intergenic
1190757511 X:53413662-53413684 GAAAAGGACAAAATGAAGCTTGG + Intronic
1191749053 X:64521194-64521216 TGGAAGGCAAAGAAGAAGCAAGG - Intergenic
1192295455 X:69842865-69842887 CAGAAGGCAAAGGTGGAGCAGGG - Intronic
1192968394 X:76204789-76204811 GAAAAGTCAAAGATAAAGAAAGG - Intergenic
1193050791 X:77097097-77097119 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
1193535608 X:82711611-82711633 GAATAGGCAAACAAAAAGCAGGG - Intergenic
1193653440 X:84168411-84168433 GAAAGAGCAGATATGAAGCAGGG - Intronic
1193850373 X:86530533-86530555 CAGAAGGCAAAGGAGAAGCAAGG - Intronic
1194169617 X:90565180-90565202 TGAAAGGCAAAGGGGAAGCAAGG - Intergenic
1194257337 X:91651158-91651180 CAAAAGTCAAAGATAAAGAAAGG - Intergenic
1194438732 X:93902094-93902116 CAGAAGGCAAAGAAGAAACAAGG - Intergenic
1194538171 X:95133880-95133902 GAAAAGGCAAAAATAATCCATGG + Intergenic
1194631417 X:96290030-96290052 GAAAAGTCAAAGAAAAAACATGG + Intergenic
1194779706 X:98009972-98009994 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1194839095 X:98716152-98716174 CAGAAGGCAAAGGTGGAGCAAGG - Intergenic
1195002511 X:100655732-100655754 GAAAAGGAAAACATGTAGCATGG + Intronic
1195127805 X:101825342-101825364 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1195167964 X:102239020-102239042 GAGAAGGCGAAGGGGAAGCAAGG + Intergenic
1195190893 X:102448067-102448089 GAGAAGGCGAAGGGGAAGCAAGG - Intronic
1195437298 X:104859936-104859958 GAAAATGCAAAGATTAAAAATGG - Intronic
1196011426 X:110892051-110892073 CAGAAGGCAAAGGAGAAGCAAGG + Intergenic
1196388351 X:115183744-115183766 TAAAAGAAAAACATGAAGCATGG + Intronic
1196929974 X:120672123-120672145 GAAATGGAAAGGATGAAGCATGG + Intergenic
1197380641 X:125734499-125734521 TAAAAGTAAAAAATGAAGCAAGG - Intergenic
1197801144 X:130350619-130350641 GAAAAGGAAAAGAAAAAGAAAGG - Intronic
1197835154 X:130686385-130686407 CAGAAGGCAAAGATGGAGCGAGG - Intronic
1198273933 X:135083381-135083403 CAAAAGGCAAAAAAGAATCAAGG - Intergenic
1198311706 X:135431122-135431144 GAAAAGGGAAAAATGAAGGAGGG - Intergenic
1198370010 X:135981231-135981253 TGGAAGGCAAAGAGGAAGCAAGG + Intergenic
1198424641 X:136504534-136504556 GACAAGACAAAGATGAGGCGAGG - Intronic
1198497008 X:137203258-137203280 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1198551634 X:137751534-137751556 GGAAAGGCAAAGATGGAGCAGGG - Intergenic
1198693429 X:139308538-139308560 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1198865748 X:141121095-141121117 AGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1199306063 X:146268895-146268917 GTGAAGGCAAAGGGGAAGCAAGG - Intergenic
1199569764 X:149255641-149255663 GAAAAGGAAAAGAAGAACAAGGG + Intergenic
1199931680 X:152530007-152530029 TAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1199931973 X:152531991-152532013 TAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1200515855 Y:4142954-4142976 TGAAAGGCAAAGGGGAAGCAAGG - Intergenic
1200575995 Y:4890111-4890133 CAAAAGTCAAAGATGAAGAAAGG - Intergenic
1200740714 Y:6850708-6850730 AAGAAGGCAAAGATCATGCATGG + Intergenic
1201330867 Y:12819395-12819417 AAAAATGCAAAAATTAAGCATGG + Intronic
1201355579 Y:13093918-13093940 GAAAATGCACAAATAAAGCAAGG + Intergenic
1201412268 Y:13711905-13711927 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1202374426 Y:24220653-24220675 GAAAAGAAAAAAATGAAGAATGG + Intergenic
1202496354 Y:25449467-25449489 GAAAAGAAAAAAATGAAGAATGG - Intergenic