ID: 1038411414

View in Genome Browser
Species Human (GRCh38)
Location 8:27362342-27362364
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038411414_1038411424 29 Left 1038411414 8:27362342-27362364 CCTTATGCTGGTGAGACCCAGAG No data
Right 1038411424 8:27362394-27362416 TCTTCTAGCCCAATGGAGAAGGG No data
1038411414_1038411423 28 Left 1038411414 8:27362342-27362364 CCTTATGCTGGTGAGACCCAGAG No data
Right 1038411423 8:27362393-27362415 CTCTTCTAGCCCAATGGAGAAGG No data
1038411414_1038411422 22 Left 1038411414 8:27362342-27362364 CCTTATGCTGGTGAGACCCAGAG No data
Right 1038411422 8:27362387-27362409 CTGTGGCTCTTCTAGCCCAATGG No data
1038411414_1038411417 5 Left 1038411414 8:27362342-27362364 CCTTATGCTGGTGAGACCCAGAG No data
Right 1038411417 8:27362370-27362392 GTGTTAGCACCCCCACACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038411414 Original CRISPR CTCTGGGTCTCACCAGCATA AGG (reversed) Intronic