ID: 1038411417

View in Genome Browser
Species Human (GRCh38)
Location 8:27362370-27362392
Sequence GTGTTAGCACCCCCACACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038411414_1038411417 5 Left 1038411414 8:27362342-27362364 CCTTATGCTGGTGAGACCCAGAG No data
Right 1038411417 8:27362370-27362392 GTGTTAGCACCCCCACACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038411417 Original CRISPR GTGTTAGCACCCCCACACTG TGG Intronic