ID: 1038411417

View in Genome Browser
Species Human (GRCh38)
Location 8:27362370-27362392
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038411414_1038411417 5 Left 1038411414 8:27362342-27362364 CCTTATGCTGGTGAGACCCAGAG 0: 1
1: 0
2: 1
3: 14
4: 171
Right 1038411417 8:27362370-27362392 GTGTTAGCACCCCCACACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr