ID: 1038412084

View in Genome Browser
Species Human (GRCh38)
Location 8:27366804-27366826
Sequence GGCTGTGTGTGGAGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038412078_1038412084 14 Left 1038412078 8:27366767-27366789 CCCACTCAAGCATGTCAAGGGGT 0: 1
1: 0
2: 1
3: 9
4: 69
Right 1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG No data
1038412079_1038412084 13 Left 1038412079 8:27366768-27366790 CCACTCAAGCATGTCAAGGGGTG 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG No data
1038412074_1038412084 28 Left 1038412074 8:27366753-27366775 CCAGCTCTGAGACTCCCACTCAA 0: 1
1: 0
2: 2
3: 36
4: 230
Right 1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038412084 Original CRISPR GGCTGTGTGTGGAGAGCAGA GGG Intronic
No off target data available for this crispr