ID: 1038413077

View in Genome Browser
Species Human (GRCh38)
Location 8:27373411-27373433
Sequence TTAGCTACTTTCTAGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038413077_1038413081 -5 Left 1038413077 8:27373411-27373433 CCCTCCAACTAGAAAGTAGCTAA 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1038413081 8:27373429-27373451 GCTAAACAACTGGAGAGAATTGG No data
1038413077_1038413082 1 Left 1038413077 8:27373411-27373433 CCCTCCAACTAGAAAGTAGCTAA 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1038413082 8:27373435-27373457 CAACTGGAGAGAATTGGCCTTGG No data
1038413077_1038413083 2 Left 1038413077 8:27373411-27373433 CCCTCCAACTAGAAAGTAGCTAA 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1038413083 8:27373436-27373458 AACTGGAGAGAATTGGCCTTGGG No data
1038413077_1038413086 19 Left 1038413077 8:27373411-27373433 CCCTCCAACTAGAAAGTAGCTAA 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1038413086 8:27373453-27373475 CTTGGGCAAGCAGCTAGGAGAGG No data
1038413077_1038413084 14 Left 1038413077 8:27373411-27373433 CCCTCCAACTAGAAAGTAGCTAA 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1038413084 8:27373448-27373470 TTGGCCTTGGGCAAGCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038413077 Original CRISPR TTAGCTACTTTCTAGTTGGA GGG (reversed) Intronic
900170454 1:1265747-1265769 TCAGCTACTTGCTACTTGGGAGG - Intronic
901299919 1:8192192-8192214 TTACCTATTTTCTACTTGGACGG + Intergenic
902210951 1:14904129-14904151 TCAGCCACTTCCTAGTTGTATGG + Intronic
902720602 1:18301769-18301791 CTGGCAACTTTCTACTTGGAGGG - Intronic
903374407 1:22856784-22856806 TTAGGTACTTTCCAGGTGGCAGG - Intronic
904516798 1:31062088-31062110 TCTGCTACTTGCTAGTTGAATGG - Intronic
906248500 1:44293683-44293705 TTTACTGCTTTCTAGTTGTAGGG - Intronic
906273082 1:44496777-44496799 TTAGCAACTTGCTAGGAGGACGG - Intronic
908140653 1:61180717-61180739 TCAGCTTCTATCTAGGTGGATGG + Intronic
908965500 1:69757265-69757287 TTAGCCAATTTCTGGTTGGAAGG - Intronic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
917109594 1:171532391-171532413 TCAGCTACTTGCTGCTTGGAGGG - Exonic
917715411 1:177732103-177732125 TTAGCTCTTTTCTAGTTGTATGG - Intergenic
920010351 1:202862472-202862494 TTAGCTCCTTTCTTTTTGGGAGG + Intergenic
923669744 1:236030184-236030206 ATAGCTACGTCCTGGTTGGATGG + Intronic
924375815 1:243407282-243407304 TTTGCTACTTACTAGCTGCATGG + Intronic
1063032850 10:2253515-2253537 GTAGCTTCCTTCTAGCTGGAAGG + Intergenic
1066658142 10:37713362-37713384 TTCTGTCCTTTCTAGTTGGATGG - Intergenic
1066824354 10:39546867-39546889 TTTGCTACTCTATATTTGGACGG + Intergenic
1071133622 10:82426508-82426530 TTAGCTTCTTTCTTGTTGTGAGG + Intronic
1071918393 10:90322423-90322445 ATAGATTATTTCTAGTTGGATGG - Intergenic
1072981456 10:100101245-100101267 TCAGCTAACTTCTAATTGGAGGG - Intergenic
1078476851 11:11637724-11637746 TCTGCTACTTTCTAGTTACAGGG - Intergenic
1079593024 11:22204578-22204600 TTGGCTATTTGCTAGTTGGCTGG + Intronic
1080691096 11:34558714-34558736 TTCGCTACACTTTAGTTGGATGG - Intergenic
1082016916 11:47496270-47496292 TTAGCTATTCTGTTGTTGGATGG - Intronic
1083251499 11:61470819-61470841 TTAGCCACTATCTAATTGAAAGG + Intronic
1087629303 11:100631753-100631775 TTGGCTATTTGCTAGTTTGATGG - Intergenic
1087653340 11:100894542-100894564 TTAGCTACTTTCAAGTCACATGG - Intronic
1091720316 12:2808562-2808584 TTGGCCCCTTTCTAGTTGGAAGG - Intergenic
1092212174 12:6653498-6653520 TTCAGTACTTTTTAGTTGGAAGG - Intronic
1092600690 12:10059866-10059888 TTTGCCATTTTCTCGTTGGATGG - Intronic
1092630466 12:10370889-10370911 TTATCTCCTTTCCACTTGGATGG + Intergenic
1093143351 12:15536003-15536025 TTAGCTTCTTTCTAGCTGACTGG - Intronic
1093630567 12:21404115-21404137 TCAGTAACTTTCTAGCTGGATGG + Intronic
1093709733 12:22316776-22316798 TTAGCCACTTTCTTCTTGGGTGG - Intronic
1093728842 12:22544877-22544899 TTAGCTGGTTTCTACTTGGAAGG + Intergenic
1098071824 12:66684143-66684165 TTAGCCACTTTGTATTTGGTAGG + Intronic
1099650555 12:85422291-85422313 TTGCCTACTTTCTAGTTTGTTGG - Intergenic
1100154423 12:91781089-91781111 CTAGCCACTTTGTAGTTTGATGG + Intergenic
1102822233 12:115917573-115917595 TTAGCTTCTTTTAAGTTGGCTGG - Intergenic
1106496969 13:30287020-30287042 TTAGTTACTTTCTAGATATAAGG - Intronic
1107310150 13:39068589-39068611 ATAGGTACTTTCTACTTGGCAGG + Intergenic
1107815354 13:44239788-44239810 TCAACTAATTTCAAGTTGGAAGG - Intergenic
1107944461 13:45405586-45405608 TTAGCAAATTTTAAGTTGGATGG + Intronic
1109129688 13:58567228-58567250 TTGCCCATTTTCTAGTTGGATGG + Intergenic
1110348512 13:74477841-74477863 TTAGCTACTTGGTAGTTGTTGGG + Intergenic
1112551715 13:100427659-100427681 TTAAGTACTCTCTAATTGGAAGG + Intronic
1113171339 13:107507221-107507243 TTAGGGATTTTCTAGTTGGCAGG + Intronic
1114331723 14:21643723-21643745 TTTGCTACTCTCTAGTTGGGTGG + Intergenic
1116954416 14:50909572-50909594 TGAACCAGTTTCTAGTTGGAAGG - Intronic
1118131411 14:62968317-62968339 ATATCTACTTTCTACTTTGAGGG - Intronic
1119101170 14:71881185-71881207 TTAGTTACTTCCTAGATGCAAGG - Intergenic
1119659248 14:76438756-76438778 TTTGCAAATTTCTAGTTTGAGGG - Intronic
1124431542 15:29612903-29612925 TTTGTTACCTTATAGTTGGAGGG - Intergenic
1128420971 15:67491417-67491439 GTAGCCACATTCTAGTTGCAAGG - Intronic
1131952806 15:97699699-97699721 TTAGCTTATTCCTATTTGGAAGG - Intergenic
1132133852 15:99312760-99312782 TTAGCTACATTATAATTGTATGG + Intronic
1133289318 16:4708266-4708288 TTTGTTAATTTCTAGATGGAAGG - Intronic
1133344836 16:5062873-5062895 TCATATACTTTCTTGTTGGATGG + Intronic
1137062508 16:35804278-35804300 TTAATTGCTTTCTACTTGGAAGG + Intergenic
1137062750 16:35806801-35806823 TTAATTGCTTTCTACTTGGAAGG - Intergenic
1137932004 16:52597733-52597755 TTGGCTACTTTCCAGCTGCAAGG + Intergenic
1139302235 16:65955270-65955292 TGATCTAGTTTCTAGTGGGATGG - Intergenic
1142680086 17:1542362-1542384 TTAGCCACAGGCTAGTTGGAGGG - Intronic
1142801433 17:2348464-2348486 TTAGATCATTTCTAGATGGAAGG - Intronic
1142946799 17:3436267-3436289 TTGGCTGCTTTAAAGTTGGAGGG - Intergenic
1144093435 17:11878255-11878277 TTAACTACTTTCCTGTTGAATGG + Intronic
1145406595 17:22602866-22602888 ATAGCTACTTTGTAGTCTGAAGG - Intergenic
1145840223 17:27988420-27988442 TCAGCCACTTTCTAGCTGGGTGG + Intergenic
1148973053 17:51501144-51501166 CTAGGTATTTTCTAGTAGGAAGG - Intergenic
1149011635 17:51863027-51863049 GTGGCAACTTACTAGTTGGATGG + Intronic
1149594324 17:57855232-57855254 CTAGCTACTCGCTACTTGGAAGG + Intergenic
1150876980 17:68981462-68981484 TTGGCATCTTTCCAGTTGGAAGG - Intronic
1153001783 18:462469-462491 TAAGCTACTTTCTGGTTCTATGG - Intronic
1159045499 18:63366301-63366323 TTTGCTGTTTTCTAGTGGGAAGG - Intronic
1159211059 18:65322787-65322809 TTAGCTATTTTTTAGTACGAAGG - Intergenic
1162285820 19:9738000-9738022 TTAGCTGCTTTTTGTTTGGAGGG + Intergenic
1167113563 19:47475727-47475749 TAAGCGAATTTCTAGTGGGAGGG + Intronic
924966535 2:81599-81621 TCAGGTACTTGCTAGCTGGACGG - Intergenic
926543894 2:14214485-14214507 TCAGCTATTTTTTAGTTGGTTGG - Intergenic
927521630 2:23702563-23702585 TAAGCTACTAGCTAGGTGGATGG - Intronic
928504879 2:31940654-31940676 CTAGCTACTTGGTAGATGGAGGG - Intronic
929382959 2:41374146-41374168 TGAGCTACTTACTGCTTGGAGGG - Intergenic
929716243 2:44313640-44313662 TTAGGTACTTTCTAGTTAAAAGG + Intronic
933516004 2:83302781-83302803 TGAGGTAATTTCTATTTGGAAGG - Intergenic
936317297 2:111434476-111434498 TTAGCCACTTTATAGTCTGATGG + Intergenic
939120806 2:138114106-138114128 TTAGCATGTTTCTGGTTGGAGGG - Intergenic
940067885 2:149650062-149650084 TTAGCTACTTTATAGTTGAGTGG + Intergenic
940759058 2:157717780-157717802 TTATCTGTTTTCTAGTTAGAGGG - Intergenic
946641580 2:221789425-221789447 TTAAATTCTTTCTAGTTTGAAGG + Intergenic
1172360465 20:34309416-34309438 TCAGCTACTTGTGAGTTGGAAGG + Intronic
1179392055 21:41002909-41002931 TTAGCTCTTTTCTTGTTGGAAGG + Intergenic
1184842306 22:47059152-47059174 TTTGCTACTTACCAGCTGGATGG - Intronic
949506520 3:4733414-4733436 TTAGCCACCATCTAGTTGCAGGG - Intronic
952661053 3:35847651-35847673 TTAGCTATTTTCTTATTGGTTGG + Intergenic
954063830 3:48090079-48090101 TGAGCTCCTTTGTAGTTAGATGG + Intergenic
955009361 3:54999058-54999080 TTAACTAATTTCCAGTTGGAGGG + Intronic
959840900 3:110973285-110973307 TTATCTTCTTTCTTGTTGGGAGG + Intergenic
960593164 3:119384846-119384868 TAATCTACTTTCTAGTTGTATGG + Intronic
960847067 3:122014014-122014036 TTTGCTACTTTCTAGCTGTGTGG - Intronic
962218535 3:133543310-133543332 TTACCTACTTTGTACTTGCAAGG - Intergenic
962314691 3:134351771-134351793 TTAGGAACTTTCTGGTTGGCTGG - Intergenic
963184945 3:142404501-142404523 TTTCCTTCTTTCTAGTTGGGTGG + Intronic
970664236 4:18318791-18318813 TGAGCTACTTCCTAGTTGCTGGG - Intergenic
971699199 4:29947113-29947135 CTAGCTACTTACTACTTGGGAGG + Intergenic
974268854 4:59623546-59623568 TTACCAACTTTCTAGTTAGCGGG - Intergenic
977173554 4:93792393-93792415 TAAGCCACTTTCTTCTTGGAAGG + Intergenic
978348147 4:107793417-107793439 TTTGCTACATTCTAGTTGCTGGG - Intergenic
979478610 4:121187644-121187666 TCAGCTACATTTCAGTTGGAGGG - Intronic
981399429 4:144295901-144295923 TAAGCTACTTGCTAGTTGCATGG + Intergenic
990519361 5:56563649-56563671 CTATCCACTTTCTAGCTGGATGG - Intronic
991286859 5:64986936-64986958 TTAGCTTTTTTCTTGTTGCAAGG + Intronic
991908104 5:71532527-71532549 TTAGCTAATTTCTCTTTGTAAGG + Intronic
992215932 5:74524598-74524620 TTAGTTACTTTCTAGATACAGGG - Intergenic
992637232 5:78736504-78736526 ATAGCCTCTTTCTATTTGGATGG + Intronic
993354545 5:86889857-86889879 TAAGCTACTTACTAGTTTCATGG - Intergenic
993838575 5:92847117-92847139 TTAGGAACTTTCTAAATGGAGGG - Intergenic
994001775 5:94789884-94789906 TTAGATAATTTTTATTTGGAAGG + Intronic
996033688 5:118734312-118734334 TTAGTTACTTTCTAGATACAAGG - Intergenic
997803500 5:136890172-136890194 TCAGCTACTTGTTAGTTGTATGG + Intergenic
1000033890 5:157427739-157427761 TTAACTTCTTTCTGGTTGGAGGG - Intronic
1001461608 5:171920039-171920061 TCAGCTACTTGCTACTTGGGAGG + Intronic
1003568118 6:7237671-7237693 TTTGCTACTTTCTATATAGATGG + Intronic
1005021124 6:21419655-21419677 TTAGTTACATTTTAATTGGAAGG + Intergenic
1005204635 6:23387975-23387997 TCAGCTACTTTCTAAGTGTATGG + Intergenic
1005874711 6:30002174-30002196 TTAGCTACTTCCAACCTGGAAGG + Intergenic
1006883629 6:37361159-37361181 TTAGGTACTTTCTAATTGCTGGG - Intronic
1007122014 6:39390103-39390125 TTTGCTACTTCTTAGTTGAATGG + Intronic
1009009553 6:57825480-57825502 GAAGCTACTTTCTAGTTGATAGG - Intergenic
1009580045 6:65521449-65521471 TTACTAACTTTCTATTTGGAAGG - Intronic
1010086233 6:71921427-71921449 TTAGCTACTTTCTTGTCAAAGGG + Intronic
1013649827 6:112183190-112183212 TTAGTTACTTTCTTGATAGAAGG + Intronic
1014563099 6:122914456-122914478 TTAGGTACTTCCTAGATAGAAGG - Intergenic
1015411355 6:132897502-132897524 TTAGGTACCTTCTAGTTTGCAGG + Intergenic
1016025719 6:139284812-139284834 TTAGCTACTTTTCAGTTAAATGG - Intronic
1017949194 6:159121490-159121512 CTTGCTACTTTCTAGTTAGTTGG - Intergenic
1021617501 7:22517902-22517924 TTTGCCCCTGTCTAGTTGGAGGG + Intronic
1022141230 7:27494656-27494678 TTAACTAATTTCTAGTGTGATGG - Intergenic
1022896572 7:34755976-34755998 TTCCCTACTTGCTAGTTGTATGG - Intronic
1022927085 7:35067316-35067338 TTTGCCCCTGTCTAGTTGGAGGG + Intergenic
1022963221 7:35450001-35450023 TAAGCCACTTCCTAGTTGCATGG + Intergenic
1027952512 7:84835772-84835794 TGTGCTACGTTCTAGTTGGATGG + Intergenic
1028375177 7:90138208-90138230 TTTGCCCCTGTCTAGTTGGAGGG - Intergenic
1029812062 7:103059153-103059175 CTAGCTACTTGCTAGGTGGGAGG + Intronic
1032116015 7:129117939-129117961 TTAGCTACTTTTTTTTTAGACGG + Intergenic
1033169957 7:139075207-139075229 TGAGCTACTTTCTGGTTGCTAGG - Intronic
1034227558 7:149495792-149495814 TAAGATACTATCTATTTGGAAGG + Intronic
1034824314 7:154247830-154247852 CTGGCTTCTTTCTAGTTTGAAGG - Intronic
1038413077 8:27373411-27373433 TTAGCTACTTTCTAGTTGGAGGG - Intronic
1040465320 8:47689530-47689552 TTTCCTACTTTCCAGTTGTATGG - Intronic
1041901492 8:62987925-62987947 TTAGTTACTTTCTAGATACAAGG + Intronic
1045374656 8:101559164-101559186 TTAGCTACCTACCATTTGGAAGG - Intronic
1046713997 8:117547353-117547375 TCAGCTACTTTCTAGCTGTGTGG - Intergenic
1046751039 8:117926789-117926811 TTATTTACCTTCTATTTGGATGG + Intronic
1048568296 8:135626949-135626971 TAAGCAACTTTGTAGTAGGAAGG + Intronic
1049121092 8:140738616-140738638 TTAGATACTTCCGGGTTGGAGGG + Intronic
1050595487 9:7200446-7200468 TTTGCTACTCTCATGTTGGAGGG - Intergenic
1050851719 9:10295876-10295898 TTTGCTACTTTGAAGATGGAAGG + Intronic
1052120806 9:24714199-24714221 TTAGCTACTTCCTAGTTACACGG + Intergenic
1055503848 9:76928721-76928743 TTGGGTATTTTCTAGTGGGAGGG + Intergenic
1056958814 9:91103951-91103973 TTTGCCACTTTCTAGTTGTTTGG - Intergenic
1059984540 9:119809266-119809288 CGAGAAACTTTCTAGTTGGAAGG - Intergenic
1186925576 X:14330026-14330048 TTTGCTACTTACTAGTTGTGTGG - Intergenic
1188594936 X:31888389-31888411 TTAGCTATTTTCAAGGTAGAGGG - Intronic
1191934816 X:66415746-66415768 TCTGCTACTTTCTAGTTAAATGG + Intergenic
1193863195 X:86696538-86696560 TTATCTTTTTTCTAGTTGCAAGG - Intronic
1197069039 X:122271138-122271160 TTAGGTGCATTCTATTTGGAAGG - Intergenic
1199230724 X:145434610-145434632 TTAGCTAATTTTTACATGGACGG - Intergenic
1199509227 X:148601624-148601646 ATTCCTACTTTCTCGTTGGAGGG - Intronic
1200752057 Y:6955143-6955165 TTTGCTAGTTTCTTTTTGGAGGG + Intronic