ID: 1038414264

View in Genome Browser
Species Human (GRCh38)
Location 8:27382189-27382211
Sequence CTTTGGAAGGCCAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038414264_1038414270 -8 Left 1038414264 8:27382189-27382211 CCATCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1038414270 8:27382204-27382226 TTCCAAAGTGCTGGGATTATAGG 0: 1158
1: 38766
2: 329426
3: 249898
4: 134520
1038414264_1038414272 11 Left 1038414264 8:27382189-27382211 CCATCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1038414272 8:27382223-27382245 TAGGTGTGAGCCACCACACCTGG 0: 404
1: 6527
2: 27823
3: 79708
4: 158090

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038414264 Original CRISPR CTTTGGAAGGCCAAGGTGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr