ID: 1038414551

View in Genome Browser
Species Human (GRCh38)
Location 8:27384843-27384865
Sequence AAACAACCTCAGACAGCGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038414551_1038414553 24 Left 1038414551 8:27384843-27384865 CCAAGCGCTGTCTGAGGTTGTTT 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1038414553 8:27384890-27384912 ATTAGAACCCAGAGCCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038414551 Original CRISPR AAACAACCTCAGACAGCGCT TGG (reversed) Intronic
906816759 1:48887484-48887506 AAAATACCTCACACAGCCCTGGG - Intronic
907339818 1:53726881-53726903 AAACAACATCAGACAGAGTCAGG + Intronic
907864348 1:58384974-58384996 AAACAACTTCAGACACACCTAGG + Intronic
911141316 1:94505462-94505484 CAACAACCTCACAAAGTGCTGGG + Intronic
912491957 1:110067368-110067390 AGACAGCCTGAGACAACGCTGGG + Intronic
914406386 1:147377970-147377992 AAACAACTTCAGAAAGATCTCGG - Intergenic
921407075 1:214791772-214791794 AAACAACTTCAGACTGTGTTAGG + Intergenic
923727577 1:236520725-236520747 AAATCACCTCGGACAGCCCTGGG - Intronic
924269640 1:242319098-242319120 AAACAACCACAAACAACCCTGGG - Intronic
1063947898 10:11195235-11195257 TAACACTCTCAGACAGCACTTGG - Intronic
1066715267 10:38279680-38279702 AAACAACCACAAACAACCCTGGG + Intergenic
1071452020 10:85804464-85804486 AAACAACTTCAGACAGAACAGGG + Intronic
1073518402 10:104100873-104100895 AAACAAACCCAGACATCACTGGG + Intergenic
1073668836 10:105564496-105564518 AAACAAACTCAGAAAGCCCAAGG - Intergenic
1074467207 10:113694154-113694176 ACACAACCACAGACAATGCTTGG - Intronic
1080681956 11:34485817-34485839 AATCAACCTCCACCAGCGCTGGG + Intronic
1083232886 11:61334181-61334203 AAACAGACTCAGAGAGCTCTAGG - Intronic
1088511394 11:110579454-110579476 AAAGAGCCTCAGCCAGCTCTTGG - Exonic
1089884389 11:121805339-121805361 AAAAAACCTCAGAGACCACTTGG - Intergenic
1098757235 12:74380551-74380573 AAACAACATCAGACAGAGGTAGG + Intergenic
1101321174 12:103674243-103674265 AAAGAACCTCAGTCTGAGCTGGG + Intronic
1102678951 12:114677193-114677215 AAATACCATCAGACAGAGCTGGG - Intronic
1107967101 13:45607043-45607065 AAACAACCCCAGAGGGCTCTGGG + Intronic
1115396644 14:32916823-32916845 AAAAGACCTCACACAGCCCTAGG - Intergenic
1117913824 14:60657205-60657227 GAACAACCCCAGAGAGCGCCGGG - Intronic
1129429449 15:75488321-75488343 GAACAACCTCAGTCAATGCTGGG + Intronic
1132927842 16:2440836-2440858 ACTCAACCTCCTACAGCGCTGGG - Intronic
1135856073 16:26011613-26011635 ACACAACCTCAGCCTGCGTTTGG + Intronic
1146704441 17:34990568-34990590 AAATAAACTCAGACCGCGCATGG - Intronic
1147716843 17:42514284-42514306 AAAGCACCTCAGACAGCTCTGGG - Exonic
1152515386 17:80820573-80820595 TAACAACCTACGACAGAGCTTGG - Intronic
1156029017 18:32690738-32690760 AAACAAAATAAAACAGCGCTAGG + Intronic
1163283088 19:16329083-16329105 ACACCAACTCAGGCAGCGCTAGG + Intergenic
1164551976 19:29219511-29219533 AGACAAACCCAGACAGCCCTGGG + Intergenic
1164743903 19:30596947-30596969 AAACAGCCCCAGAAAGCGATGGG - Intronic
1168054410 19:53853976-53853998 AAACAACCTCTGCCTGCCCTTGG - Intergenic
1168097851 19:54125681-54125703 AAAAAACCCCACACAGGGCTGGG - Intronic
926973911 2:18494518-18494540 AAACACCCTCAGAGAGACCTGGG + Intergenic
930397025 2:50835062-50835084 AGACAACCTCAGACAGCCCAGGG + Intronic
938388052 2:130881947-130881969 ACAGAGCCTCAGGCAGCGCTTGG + Intronic
945257866 2:207817322-207817344 ATACAACCTCAGGCAGCTGTTGG - Intergenic
1172038139 20:32024837-32024859 AAATAACCACAGACTGTGCTGGG + Intronic
1172480802 20:35270262-35270284 AAACAACCTAGCACAGTGCTGGG - Intronic
1174802757 20:53578605-53578627 AAACAACCTCCAACAGCATTTGG - Intronic
1175180221 20:57141214-57141236 AAACAACCTAAGTTAGAGCTGGG - Intergenic
1175521918 20:59607303-59607325 AAACAACCTCAGTCACTTCTTGG + Intronic
1176139468 20:63538676-63538698 AACCGACCCCAGACAGAGCTGGG - Intergenic
1179849959 21:44132735-44132757 AAACAAACCCAAACAGCGCCCGG + Intergenic
1180631783 22:17234842-17234864 AAACAACCCCAAACAGGGCTTGG + Intergenic
1181662247 22:24360504-24360526 AAACAGACTCAGCCAGCGTTGGG + Intronic
1183208441 22:36434954-36434976 AAACAAACACAGACAGAGCAGGG + Intergenic
1183695670 22:39420625-39420647 AAAACACTTCAGACAGTGCTGGG + Intronic
1184258416 22:43300693-43300715 AAGCAGCCTCAGGCAGCACTAGG + Intronic
1184843998 22:47070000-47070022 AAACAACAGGGGACAGCGCTGGG - Intronic
949833290 3:8240137-8240159 AACCAGCCGCAGACAGAGCTGGG + Intergenic
949937713 3:9129606-9129628 AAAAAAACCCAAACAGCGCTAGG - Intronic
950546272 3:13639836-13639858 AAACAAGCTCAGGCATCCCTAGG + Intergenic
951365673 3:21779091-21779113 AATCAACCACAGTCAGAGCTGGG + Intronic
953761215 3:45688804-45688826 AAACCACCTCAGACAACTCCAGG + Intergenic
953799531 3:46011694-46011716 AAGTAGCCTCAGGCAGCGCTGGG + Intergenic
954318488 3:49814301-49814323 AAAGAACTTAAGACAGCACTTGG - Intergenic
955776061 3:62434702-62434724 AAACTAGCTCAGAGAGCACTGGG + Intronic
961103781 3:124223733-124223755 ACAAAACCACAGACAGGGCTGGG + Intronic
964199106 3:154098083-154098105 AAAGATCCTCAGGCAGCCCTGGG - Intergenic
970157458 4:13155377-13155399 AAACAGCCTCAGACAGGTCCTGG + Intergenic
978469805 4:109052377-109052399 AAGCAAACTCAAACAGCACTTGG + Intronic
987250210 5:16092814-16092836 AAACAACTTCAGACACATCTTGG - Intronic
988442432 5:31247926-31247948 AAATAACCTCTCACAGCTCTTGG - Intronic
988787123 5:34575369-34575391 AAACAACCTCAGAGAGCAAAAGG - Intergenic
991450896 5:66749654-66749676 AAAGCACCTAAGACAGTGCTTGG - Intronic
994349726 5:98730561-98730583 AAAAAACCTAAGACACGGCTAGG + Intergenic
998183379 5:139961125-139961147 AAACAGCCTGAGTCAGAGCTGGG - Intronic
999799074 5:155016514-155016536 AAACAGCCTGAGACAGAGCAAGG + Exonic
1004888095 6:20071103-20071125 AAACAACCTCAGGCTTCCCTTGG + Intergenic
1016252090 6:142055814-142055836 ACACAATCTCAGGCAGCCCTAGG - Intergenic
1016709172 6:147150120-147150142 AAACAAACTCAGAAAATGCTAGG + Intergenic
1017696854 6:157024238-157024260 AAACAACCTTGGTCAGCGTTTGG - Intronic
1024638492 7:51310241-51310263 AAGCATCATCAGACAGCCCTGGG + Intronic
1026893816 7:73998702-73998724 AGAAATTCTCAGACAGCGCTGGG + Intergenic
1031212248 7:118845454-118845476 AAATATCCTAAGACAGAGCTAGG + Intergenic
1033169438 7:139070678-139070700 AAAAAACCTCAGGAAGGGCTGGG + Intronic
1037527611 8:19742129-19742151 AAAACAACTGAGACAGCGCTTGG + Intronic
1038414551 8:27384843-27384865 AAACAACCTCAGACAGCGCTTGG - Intronic
1039720481 8:40159111-40159133 AAACAACCCCAGACTGAGCCTGG + Intergenic
1042285931 8:67110152-67110174 AAAAAACCTCAGACTGCACCTGG - Intronic
1043959763 8:86403652-86403674 AAAAACTCTCAGACAGCTCTTGG - Intronic
1044055679 8:87566642-87566664 AAAAATCCTCTGACAGAGCTTGG - Intronic
1044789601 8:95834205-95834227 AAACAACCTCAGAAATCTCAGGG + Intergenic
1046045678 8:108961505-108961527 AAAGAACATCAGTCAGCACTGGG + Intergenic
1048227687 8:132605084-132605106 AAAGTACCTAGGACAGCGCTTGG - Intronic
1049751085 8:144284513-144284535 AACCATCCTGAGACAGCGCACGG + Intronic
1052474398 9:28939939-28939961 AAACAGCCACAGACAATGCTGGG - Intergenic
1053410508 9:37913516-37913538 AAACAACTTCAGCAAGAGCTGGG - Intronic
1060174379 9:121486564-121486586 AAACAACCTCACAGAGAGCAGGG - Intergenic
1061318902 9:129815452-129815474 AAACAATCTCAGATGGTGCTTGG + Intronic
1062663498 9:137653473-137653495 AAAGCACCTAAGACAGTGCTTGG + Intronic
1192273551 X:69607586-69607608 AAGCAACCTGTGACAGGGCTTGG - Intergenic
1198710435 X:139495689-139495711 AGACAACCTCAGAGAGCACATGG - Intergenic
1200861492 Y:7997205-7997227 AAACAACCCCAAACAGTGATAGG + Intergenic