ID: 1038414793

View in Genome Browser
Species Human (GRCh38)
Location 8:27387026-27387048
Sequence GTGTTTGAGCAGAATTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038414789_1038414793 -2 Left 1038414789 8:27387005-27387027 CCATACATGTATGAGGAATTTGT 0: 1
1: 0
2: 2
3: 124
4: 1354
Right 1038414793 8:27387026-27387048 GTGTTTGAGCAGAATTCTGGGGG No data
1038414788_1038414793 3 Left 1038414788 8:27387000-27387022 CCTTTCCATACATGTATGAGGAA 0: 1
1: 0
2: 1
3: 24
4: 174
Right 1038414793 8:27387026-27387048 GTGTTTGAGCAGAATTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038414793 Original CRISPR GTGTTTGAGCAGAATTCTGG GGG Intronic
No off target data available for this crispr