ID: 1038415486

View in Genome Browser
Species Human (GRCh38)
Location 8:27391912-27391934
Sequence CTCAGAGCCAGGGTTTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038415478_1038415486 5 Left 1038415478 8:27391884-27391906 CCAGGAGGCAAACCGAAGCCCAG 0: 1
1: 0
2: 0
3: 12
4: 160
Right 1038415486 8:27391912-27391934 CTCAGAGCCAGGGTTTTCACTGG No data
1038415481_1038415486 -7 Left 1038415481 8:27391896-27391918 CCGAAGCCCAGGATGGCTCAGAG 0: 1
1: 0
2: 3
3: 29
4: 283
Right 1038415486 8:27391912-27391934 CTCAGAGCCAGGGTTTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038415486 Original CRISPR CTCAGAGCCAGGGTTTTCAC TGG Intronic
No off target data available for this crispr