ID: 1038416277

View in Genome Browser
Species Human (GRCh38)
Location 8:27398358-27398380
Sequence TCCAGGTACCCACCTTCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038416271_1038416277 22 Left 1038416271 8:27398313-27398335 CCTTTTGCTCACTCCTACCCAGA No data
Right 1038416277 8:27398358-27398380 TCCAGGTACCCACCTTCATCAGG No data
1038416272_1038416277 9 Left 1038416272 8:27398326-27398348 CCTACCCAGAATCACAACATCTG No data
Right 1038416277 8:27398358-27398380 TCCAGGTACCCACCTTCATCAGG No data
1038416274_1038416277 4 Left 1038416274 8:27398331-27398353 CCAGAATCACAACATCTGTTTTG No data
Right 1038416277 8:27398358-27398380 TCCAGGTACCCACCTTCATCAGG No data
1038416273_1038416277 5 Left 1038416273 8:27398330-27398352 CCCAGAATCACAACATCTGTTTT No data
Right 1038416277 8:27398358-27398380 TCCAGGTACCCACCTTCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038416277 Original CRISPR TCCAGGTACCCACCTTCATC AGG Intronic