ID: 1038416575

View in Genome Browser
Species Human (GRCh38)
Location 8:27400796-27400818
Sequence GCGTGGGTCTGGAGCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038416569_1038416575 -10 Left 1038416569 8:27400783-27400805 CCCCCACGGAGGAGCGTGGGTCT 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1038416575 8:27400796-27400818 GCGTGGGTCTGGAGCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038416575 Original CRISPR GCGTGGGTCTGGAGCTCAGG AGG Intronic
No off target data available for this crispr