ID: 1038417453

View in Genome Browser
Species Human (GRCh38)
Location 8:27407591-27407613
Sequence GTGGCTCTAAATTCTTCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 151}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038417453_1038417461 5 Left 1038417453 8:27407591-27407613 CCTTTGGAAGAATTTAGAGCCAC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1038417461 8:27407619-27407641 GACAGGTGCTCCCGGGAGGTGGG No data
1038417453_1038417458 -2 Left 1038417453 8:27407591-27407613 CCTTTGGAAGAATTTAGAGCCAC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1038417458 8:27407612-27407634 ACTACTGGACAGGTGCTCCCGGG No data
1038417453_1038417459 1 Left 1038417453 8:27407591-27407613 CCTTTGGAAGAATTTAGAGCCAC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1038417459 8:27407615-27407637 ACTGGACAGGTGCTCCCGGGAGG No data
1038417453_1038417460 4 Left 1038417453 8:27407591-27407613 CCTTTGGAAGAATTTAGAGCCAC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1038417460 8:27407618-27407640 GGACAGGTGCTCCCGGGAGGTGG No data
1038417453_1038417463 15 Left 1038417453 8:27407591-27407613 CCTTTGGAAGAATTTAGAGCCAC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1038417463 8:27407629-27407651 CCCGGGAGGTGGGTCTCCCCAGG No data
1038417453_1038417457 -3 Left 1038417453 8:27407591-27407613 CCTTTGGAAGAATTTAGAGCCAC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1038417457 8:27407611-27407633 CACTACTGGACAGGTGCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038417453 Original CRISPR GTGGCTCTAAATTCTTCCAA AGG (reversed) Intronic
905941100 1:41864111-41864133 GACTCTCTAAATTCTTCCACTGG + Intronic
907701682 1:56794392-56794414 GTGGCTCTTATTTTTTGCAATGG - Intronic
908035539 1:60047574-60047596 TTGTTTCTAAATTTTTCCAATGG + Intronic
908147984 1:61267666-61267688 GCTGCTGTAAATTGTTCCAAGGG + Intronic
908153875 1:61332698-61332720 GTGTGTCAAAATTCTTCCAATGG - Intronic
918721189 1:187854124-187854146 ATGTCTTTAAATTCTTCAAATGG - Intergenic
919283726 1:195526145-195526167 GCTGATCTAAATTCTTCCATGGG - Intergenic
919414272 1:197287576-197287598 GAGGCTCTGACTTCTTGCAAGGG + Intronic
920650672 1:207834988-207835010 TTGGCTCTAAATTGTAACAAGGG - Intergenic
921517622 1:216116591-216116613 GGGACTCTAATTTTTTCCAAGGG - Intronic
922124527 1:222709783-222709805 GTTACTCTAAAATCTTCCATTGG + Intronic
923132047 1:231084102-231084124 GTGGCACTAAACTCTACCACTGG - Intergenic
1063538926 10:6912283-6912305 GTGGCTCTGAAATCTTCAAGTGG + Intergenic
1063623503 10:7668308-7668330 GTGGGTAAGAATTCTTCCAATGG - Intergenic
1065611992 10:27481025-27481047 GTGGCTCTAACTTCTCAGAAAGG + Intergenic
1068557482 10:58475387-58475409 ATGGCTCAAAGTTCTTCCACAGG + Intergenic
1071534828 10:86419819-86419841 GTGGCTCAACATCCTTACAAAGG + Intergenic
1072927610 10:99630093-99630115 GTGGCTCTCAAATCATCCAGGGG + Intergenic
1075516831 10:123116012-123116034 GTGGCAAGAAATTTTTCCAATGG + Intergenic
1078606822 11:12784502-12784524 ATGACTCTTAATGCTTCCAATGG - Intronic
1080000203 11:27338403-27338425 TTTGCTTTAAATTCTTCTAAGGG + Intronic
1080824562 11:35837059-35837081 TTGGCTCTAAAATCTTAGAAGGG + Intergenic
1090159658 11:124479267-124479289 ATTGCTCTACATTCTTACAATGG + Intergenic
1092296325 12:7202051-7202073 CTGGCTCTAAAGACTTGCAAAGG - Intronic
1092468160 12:8753375-8753397 ATGGTTCTAAATTCTTCCCATGG - Intronic
1096139588 12:49232014-49232036 GTGGCTCTCATTTCCTCCAGAGG + Intronic
1096611530 12:52805261-52805283 GTGGCTTTGGCTTCTTCCAAGGG - Intergenic
1105330456 13:19411038-19411060 TGGGCTCTACATTGTTCCAAAGG - Intergenic
1106693599 13:32146200-32146222 GTGGCCCTAGATACTTCGAAAGG - Intronic
1108082594 13:46752277-46752299 GCTGCTCTAAAAACTTCCAATGG - Intronic
1109140005 13:58703303-58703325 TTGGTTCTAAATTTTTCCATTGG + Intergenic
1113454647 13:110439479-110439501 GTGGCTCTGACGTCTTCCACAGG + Intronic
1121771590 14:96548442-96548464 ATGGCTCTAAGTTATTCAAAAGG - Intronic
1123846569 15:24309487-24309509 TTGGCTTTAAACTTTTCCAAAGG + Intergenic
1123865577 15:24516537-24516559 TTGGCTTTAAACTTTTCCAAAGG + Intergenic
1123975459 15:25549441-25549463 GTGGCTGAAAATTTTTCAAATGG + Intergenic
1133259195 16:4537767-4537789 GTGGCTGTGAGTTCCTCCAAAGG - Intronic
1133874560 16:9721676-9721698 CTGGCTGTAGATTCTTACAATGG - Intergenic
1135090231 16:19508299-19508321 GGGGCTCCCAATTCTTCCCAAGG + Intronic
1138499201 16:57428443-57428465 GTGACACTAAGTTCCTCCAATGG + Exonic
1139641607 16:68295853-68295875 CTGGCTCAAAATTCTTCCATGGG + Intronic
1139641930 16:68297783-68297805 CTGGCTCAAAATTCTTCCCTGGG + Exonic
1144224279 17:13129648-13129670 ATGGCTCTAAATTCTTTCCTGGG + Intergenic
1146502449 17:33375648-33375670 GAGGCTCCAAAGTCATCCAAGGG + Intronic
1146553751 17:33805135-33805157 ATGCTTCTGAATTCTTCCAAGGG + Intronic
1149189328 17:54039993-54040015 TTGGCTCTAATTTCTACCCATGG + Intergenic
1154425897 18:14271898-14271920 GGGGCTTTAAATCCATCCAAAGG + Intergenic
1154428636 18:14291492-14291514 GGGGCTTTAAATCCATCCAAAGG + Intergenic
1155513554 18:26601049-26601071 GTGACACTAAGTTCCTCCAATGG - Intronic
1155870899 18:31026775-31026797 GTGGCTCTAACTAATTGCAAGGG - Intronic
1157195755 18:45619013-45619035 TTGGACCCAAATTCTTCCAATGG - Intronic
1158313595 18:56186055-56186077 CTGGATCTTTATTCTTCCAAAGG + Intergenic
1159608114 18:70496088-70496110 ATTGCTCTATTTTCTTCCAAGGG + Intergenic
1159750712 18:72298486-72298508 GTATTTCTAAATTCTTGCAATGG - Intergenic
1164338528 19:24360103-24360125 GTTCCTGTAAATTCTACCAAGGG + Intergenic
1164339099 19:24368909-24368931 GTTTCTTTAAATTCTACCAAGGG + Intergenic
1165703182 19:37954207-37954229 GTGGCTCTGATTTGTTCAAAGGG - Intronic
1167094027 19:47364096-47364118 GTGGCTCTATAATCTCCCCAGGG + Intronic
925939390 2:8801511-8801533 CAGGCTGTAAATTCTTCCAGAGG - Intronic
928921418 2:36532218-36532240 TAGGCTGTAAACTCTTCCAATGG - Intronic
929938243 2:46310651-46310673 GTGTTTCTAAATTCCTCCAGGGG - Intronic
933273647 2:80260620-80260642 GTGTCTCTGCATTCTTCCATTGG - Intronic
933632232 2:84671597-84671619 GGGGCCCCAAATTCTTACAAAGG + Intronic
935093188 2:99916739-99916761 GTGGCTCCTAATTCTGCCTAGGG - Intronic
936339996 2:111622722-111622744 GTGGCTGAAAATTCTGACAAAGG + Intergenic
940193299 2:151065317-151065339 AGGGCAGTAAATTCTTCCAATGG + Intergenic
940607529 2:155945921-155945943 GTTGTTTTAAACTCTTCCAATGG - Intergenic
940820110 2:158343711-158343733 GTGGCCCTAAATTCTCCACAAGG + Intronic
941463475 2:165798327-165798349 CTGGCTCTAAATTCTGACAGTGG + Intergenic
946087894 2:217192788-217192810 GATGCTCTCAATTCTCCCAAGGG - Intergenic
946707324 2:222471240-222471262 ATGGATCTAGATTCATCCAAAGG - Intronic
1169092643 20:2871043-2871065 GGGGCTCTGTCTTCTTCCAATGG + Intronic
1169362795 20:4965349-4965371 TTGGATCTCAACTCTTCCAAGGG + Intronic
1170002645 20:11632182-11632204 GTGGTTCCAAATTCTGCCATGGG - Intergenic
1170166501 20:13365108-13365130 TTGGCTATAAAGTCTTCCATTGG + Intergenic
1170251086 20:14283584-14283606 GTGGGTTTAATTTCTTCCAAAGG - Intronic
1170786403 20:19471377-19471399 GTGGCTCCAATTTCTTCCTTAGG + Intronic
1175354281 20:58350801-58350823 GTGGCTATTATTTCTTCCTATGG - Intronic
1176762904 21:12976515-12976537 GTGTCTCAAAATTGCTCCAAGGG + Intergenic
1176846131 21:13877931-13877953 GGGGCTTTAAATCCATCCAAAGG - Intergenic
1176848866 21:13897473-13897495 GGGGCTTTAAATCCATCCAAAGG - Intergenic
1177201773 21:17965255-17965277 AAGCCTCTAAAGTCTTCCAATGG + Intronic
1177779711 21:25608811-25608833 GTGGCTCTAAGATGTTCTAAGGG - Intergenic
1179403519 21:41106899-41106921 GTGGTTCTGAAGTCTTCCCAAGG - Intergenic
1180033885 21:45232297-45232319 CTGGCTTTATATTCTGCCAAAGG + Intergenic
1180564433 22:16650800-16650822 TGGGCTCTACATTGTTCCAAAGG + Intergenic
1184751075 22:46487093-46487115 GCAGCTCCAAATTCTTCCCATGG + Intronic
949532997 3:4976034-4976056 GGGGCTCTAAATTCTTGCACAGG + Intergenic
950520774 3:13496579-13496601 CTGGCTCTCATTTCTACCAAAGG + Intronic
950983988 3:17340670-17340692 GAGTTTCCAAATTCTTCCAAGGG + Intronic
951035210 3:17925331-17925353 GAGGGTCTTAAGTCTTCCAAAGG + Intronic
954493243 3:50927803-50927825 GTGTCTCTACATTCTGCCTAGGG + Intronic
955523629 3:59799067-59799089 GTGTTTCTAGAATCTTCCAAAGG - Intronic
955539793 3:59962092-59962114 TTGGTTCAAAAGTCTTCCAATGG - Intronic
957644092 3:82897087-82897109 GTGGCCTTAAATACTTTCAAAGG + Intergenic
957705972 3:83784505-83784527 GTGGCCTTGAATTCTTACAAAGG - Intergenic
959898793 3:111636636-111636658 TTGTCTCTAAATGCTTCAAAAGG + Intronic
960288061 3:115852023-115852045 GTGGCTCTAATTTGTTCCCAAGG + Intronic
960622718 3:119652458-119652480 GTGGCTCTCATTACTCCCAAAGG + Intronic
962740171 3:138357527-138357549 GTATTTCTTAATTCTTCCAAAGG + Intronic
963256096 3:143146293-143146315 GGGACTATAAATTCTGCCAATGG - Intergenic
963775868 3:149438886-149438908 GTTGCTCTAATTTATTCCTAAGG + Intergenic
969135171 4:5023478-5023500 GCAGCTCCAAATTCTTCCCAGGG + Intergenic
972517112 4:39818984-39819006 GTGGCACAAAATTTGTCCAAAGG + Intergenic
974359256 4:60855155-60855177 GTGGCTGTAAATTGTTCAAAGGG - Intergenic
974856650 4:67469116-67469138 GTGTCTTTAATTTCTTCCAATGG - Intergenic
976135402 4:81930771-81930793 GTGATGCTAAACTCTTCCAATGG + Intronic
982575474 4:157103701-157103723 GTGGCTTTAATTTCTTTCATTGG + Intronic
983139785 4:164135902-164135924 GGGGATCTAGATTCTTCTAAAGG + Intronic
983653864 4:170060570-170060592 GTGCCTCTAAATTCATCAGATGG - Exonic
987677592 5:21095026-21095048 TTGGCTCTAAAATTTTCAAAAGG - Intergenic
988599541 5:32626880-32626902 GTGGGTCTAAGTTCTTCAAAGGG - Intergenic
992865469 5:80953147-80953169 GAAGCTCTAAATTCCTCCAGAGG + Intergenic
994789559 5:104206388-104206410 CAGGCTCTAAAATATTCCAAAGG + Intergenic
999062274 5:148648680-148648702 GTTGCGGTAAATTTTTCCAATGG - Intronic
1001697580 5:173683511-173683533 GTCACTCTAAATTCTCACAAAGG + Intergenic
1001828530 5:174766131-174766153 GGGGCTCTAAATCCTTGCCAAGG - Intergenic
1002560744 5:180080354-180080376 GTGGCTCTGCAGACTTCCAAAGG - Intergenic
1003223573 6:4184475-4184497 GTTTCTCTAAAATATTCCAAAGG - Intergenic
1003964536 6:11240404-11240426 GTGGCTTTTAATTATCCCAAGGG + Intronic
1005926480 6:30449689-30449711 CTGTCTCCAAATTCATCCAAGGG + Intergenic
1005928199 6:30462261-30462283 TTGTCTCTAAATTCATCCAAGGG + Intergenic
1007005245 6:38356192-38356214 GTGGGTCTATTTTCTTCCAGTGG + Intronic
1007146382 6:39637822-39637844 CTGGCTTTAAATTGCTCCAATGG + Intronic
1009384302 6:63069965-63069987 ATGGCTCTAATTTCTTCTACAGG + Intergenic
1012295644 6:97518939-97518961 GGTTCTCTAAATTCTTCCATTGG - Intergenic
1012372502 6:98524790-98524812 CAGTTTCTAAATTCTTCCAATGG + Intergenic
1015253821 6:131155687-131155709 GTTTCTCTAGATTCCTCCAAAGG + Intronic
1019222678 6:170486710-170486732 ATGGCTCAAAATATTTCCAAAGG - Intergenic
1021090810 7:16480495-16480517 TTTGCTCAAAATTCTTCTAAGGG - Intronic
1021485741 7:21166440-21166462 GTGTTCCTAAATTCTGCCAATGG - Intergenic
1026555140 7:71401637-71401659 GTGGCATTAAATTCTTACAGAGG + Intronic
1030949504 7:115771963-115771985 GTGGCTTTAAATTTTTTTAATGG - Intergenic
1037634875 8:20692546-20692568 GTGGCTCTGAATATTTGCAAGGG + Intergenic
1038417453 8:27407591-27407613 GTGGCTCTAAATTCTTCCAAAGG - Intronic
1038970056 8:32623239-32623261 ATGGGTCTAAATTCCACCAATGG - Intronic
1044751425 8:95419935-95419957 GTGGCTCTAAGAACTTACAATGG - Intergenic
1046932668 8:119856393-119856415 GTGGCTCTAAAAGCTTCCTGCGG + Intergenic
1050872811 9:10595429-10595451 TTGGCTCTAAATTTCTGCAAAGG + Intronic
1054745366 9:68848547-68848569 ATGGGTGTAAATTCTTCTAAAGG + Intronic
1055870320 9:80869737-80869759 TTGGCTCTAAGTTATTGCAATGG + Intergenic
1058503768 9:105648369-105648391 ATGACTCTAATTTCTGCCAAAGG - Intergenic
1060113080 9:120920355-120920377 GTGGCTCCATGTCCTTCCAATGG - Intronic
1060788686 9:126470540-126470562 GTGGCCCTAGATTCCTCCCAGGG + Intronic
1060836432 9:126758478-126758500 GTGGCCCTAAATTCAACCATGGG + Intergenic
1186193706 X:7091043-7091065 GTGGCACTGAACACTTCCAAAGG + Intronic
1188564939 X:31516338-31516360 GTGGGTCCAATTTCTTCCTATGG - Intronic
1188727926 X:33607689-33607711 GCTGCTATAAATTCTTACAAAGG + Intergenic
1189126803 X:38456981-38457003 GTGACTTAAAAGTCTTCCAATGG + Intronic
1189202385 X:39208128-39208150 GTAGCTTTAAATTCTTTGAAAGG + Intergenic
1192501695 X:71658273-71658295 ATGGATCTAAATGATTCCAACGG + Intergenic
1192508792 X:71709297-71709319 ATGGATCTAAATGATTCCAAGGG + Intergenic
1192511882 X:71725557-71725579 ATGGATCTAAATGATTCCAATGG - Intergenic
1192514815 X:71755948-71755970 ATGGATCTAAATGATTCCAATGG + Intergenic
1192517905 X:71772256-71772278 ATGGATCTAAATGATTCCAAGGG - Intergenic
1198116092 X:133546069-133546091 GTGGCCCTAAATTCTCCACAAGG + Intronic
1198740546 X:139837272-139837294 TTGGCTGTAAATTCTTATAATGG - Intronic
1198941069 X:141955890-141955912 GTGGCTCTAACTTCTTCTTCAGG - Intergenic
1199182532 X:144875607-144875629 GAGGCTTCAAATTTTTCCAATGG + Intergenic
1200893375 Y:8347303-8347325 GTGGCTCTATTTTCTTTCCATGG + Intergenic
1201565620 Y:15362568-15362590 GTGGCACTGAACACTTCCAAAGG + Intergenic
1202600864 Y:26591772-26591794 TGGGCTCTACATTGTTCCAAAGG + Intergenic