ID: 1038417456

View in Genome Browser
Species Human (GRCh38)
Location 8:27407610-27407632
Sequence CGGGAGCACCTGTCCAGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 59}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038417456_1038417469 19 Left 1038417456 8:27407610-27407632 CCACTACTGGACAGGTGCTCCCG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1038417469 8:27407652-27407674 TGCCAGTTCCCACCCAGTCAGGG No data
1038417456_1038417470 20 Left 1038417456 8:27407610-27407632 CCACTACTGGACAGGTGCTCCCG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1038417470 8:27407653-27407675 GCCAGTTCCCACCCAGTCAGGGG No data
1038417456_1038417474 29 Left 1038417456 8:27407610-27407632 CCACTACTGGACAGGTGCTCCCG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1038417474 8:27407662-27407684 CACCCAGTCAGGGGAGTCAGAGG No data
1038417456_1038417463 -4 Left 1038417456 8:27407610-27407632 CCACTACTGGACAGGTGCTCCCG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1038417463 8:27407629-27407651 CCCGGGAGGTGGGTCTCCCCAGG No data
1038417456_1038417468 18 Left 1038417456 8:27407610-27407632 CCACTACTGGACAGGTGCTCCCG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1038417468 8:27407651-27407673 GTGCCAGTTCCCACCCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038417456 Original CRISPR CGGGAGCACCTGTCCAGTAG TGG (reversed) Intronic
902323732 1:15684744-15684766 CGGGAGCCCCGGGCCGGTAGAGG + Intronic
902505473 1:16936943-16936965 AGGGAGCATCTGTTCACTAGGGG + Intronic
903645093 1:24890657-24890679 TGGGAGCAACTGTCCAGTGAAGG + Intergenic
904687858 1:32273892-32273914 CGTGCACACCTCTCCAGTAGGGG + Intronic
915396719 1:155590648-155590670 CAGGGGCAGATGTCCAGTAGCGG + Intergenic
1068395413 10:56455601-56455623 AGGGAGCCCTTGTCAAGTAGTGG + Intergenic
1069945774 10:71984537-71984559 AGGGAGCAGCTGTACAGCAGTGG - Intronic
1070759077 10:79012185-79012207 ATGGAGCACCTGTCCAGTCTGGG - Intergenic
1072856034 10:98947866-98947888 AGGAAGCACCTTTCCAGTAAGGG + Intronic
1075088952 10:119432142-119432164 GAGGAACATCTGTCCAGTAGAGG - Intronic
1075390224 10:122086295-122086317 CGAAAGCCCCTGTCCTGTAGGGG + Exonic
1076070171 10:127482715-127482737 AGGGAGCAGCTGTGCAGAAGGGG - Intergenic
1080962034 11:37172041-37172063 CTGTAGCACCTGCCCAGTTGGGG + Intergenic
1085388872 11:76172153-76172175 GGGGAGCACCTGTCCTGTGTGGG - Intergenic
1089388211 11:118081601-118081623 CGTGCGCACCTGTCCAGGGGTGG + Intronic
1096071305 12:48776879-48776901 CGGGAGAGCCTATGCAGTAGGGG - Intronic
1099846595 12:88035467-88035489 CGGGAACGCCCGTCCAGAAGCGG - Exonic
1118055934 14:62079907-62079929 AGGTAGCACCAGTCCAGTGGTGG + Intronic
1121922478 14:97895117-97895139 GGGCAGCAGCTGTCCAGGAGAGG + Intergenic
1122702094 14:103596760-103596782 CAGGAGCACCTGTCCAGCCAGGG - Intronic
1139359360 16:66387991-66388013 TGGGGGCACCTTTCCAGGAGAGG + Intronic
1139563505 16:67758485-67758507 CGGGAGCTCCTTTCGAGAAGGGG - Intronic
1142173912 16:88636245-88636267 CAGGAGCACCTGTCCTGCTGGGG + Intergenic
1143803522 17:9405401-9405423 AGGGAGTACCTTACCAGTAGGGG - Intronic
1163861832 19:19746979-19747001 CGGGAGGAGCTGCCCAGTGGGGG - Intergenic
925282573 2:2695075-2695097 CAGGAACACATGCCCAGTAGAGG + Intergenic
938797015 2:134726078-134726100 AGTGAGGACCTGTCCAGTACAGG + Intergenic
938830271 2:135043197-135043219 AGGAATCACCTGCCCAGTAGTGG - Intronic
939074833 2:137587741-137587763 TGGGAGGAACTGCCCAGTAGGGG - Intronic
944256158 2:197625473-197625495 CGGGAGCATCTTTGAAGTAGAGG + Intronic
1171260707 20:23730151-23730173 GGGGAGTACATGTGCAGTAGTGG + Intergenic
1171276440 20:23860168-23860190 GGGGGGTACCTATCCAGTAGTGG + Intergenic
1173247684 20:41347745-41347767 CGGGAGCACCCCACCAGCAGAGG + Intronic
1174812764 20:53661112-53661134 TGGGAGCACCTGCCCCGTGGTGG + Intergenic
1175873049 20:62217370-62217392 TGCGAGCACCTGTGCAGGAGTGG - Intronic
1176272321 20:64242319-64242341 TGGGAGCACATGCCCAGGAGGGG + Intergenic
1180130127 21:45821773-45821795 CTGGAGCTCCAGTACAGTAGAGG - Intronic
1182234918 22:28867534-28867556 GAGGAGCACCTGTCCACCAGAGG + Intergenic
1183615098 22:38939291-38939313 CGGGAGCAGCTGTGCAGGAGAGG + Intergenic
1184788906 22:46687269-46687291 CTGCAGCCCCTGTCCAGGAGTGG - Intronic
960280612 3:115777653-115777675 CATAAGCAGCTGTCCAGTAGTGG + Intergenic
960763613 3:121099640-121099662 AGGAAGCTCCTGTCCAATAGAGG - Intronic
968501658 4:953008-953030 GGGGAGGACCTGGCGAGTAGAGG - Intronic
968948459 4:3677838-3677860 CGGGAGCTGCTGTGCAGTGGGGG + Intergenic
979179619 4:117708483-117708505 CTGCAACACCTCTCCAGTAGGGG + Intergenic
979540689 4:121877569-121877591 CAGGTGCACTGGTCCAGTAGAGG + Intergenic
980437206 4:132792768-132792790 CTGGAGCTCCTGTCCACTGGTGG + Intergenic
991426620 5:66498918-66498940 TGGGAGCTACTGCCCAGTAGAGG - Intergenic
995257192 5:110060260-110060282 AGGGTGCACCTTTCCAGTATAGG - Intergenic
995382607 5:111551399-111551421 GGGGAGCACCTTTCCAATAAGGG - Intergenic
1011623911 6:89268300-89268322 GGGGAGCACCAGCCCAGTAATGG - Intronic
1035931288 8:3783234-3783256 CGGGAGCACCTACACAGTATCGG - Intronic
1038417456 8:27407610-27407632 CGGGAGCACCTGTCCAGTAGTGG - Intronic
1044273173 8:90270965-90270987 TGGGAGCATCTGTCAAGTGGGGG + Intergenic
1049399814 8:142419976-142419998 CGGGAGCCCCTGGGCAGTGGAGG + Intergenic
1051486875 9:17618186-17618208 TGGTAGCACCTTTCCAGTCGTGG - Intronic
1060144366 9:121238649-121238671 CTGGAGAACCTGACCAGTACAGG + Intronic
1061007202 9:127935016-127935038 CAGGAGATCCTGTACAGTAGGGG - Intergenic
1195313826 X:103658663-103658685 CTGGAGAACCTATCCAGCAGCGG + Intergenic
1199478832 X:148274828-148274850 CTGGATCACCTCTCCAGTAAGGG + Intergenic
1199504974 X:148551655-148551677 GGAGAGCACCTGTGCAGTAAAGG + Intronic