ID: 1038417463

View in Genome Browser
Species Human (GRCh38)
Location 8:27407629-27407651
Sequence CCCGGGAGGTGGGTCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038417453_1038417463 15 Left 1038417453 8:27407591-27407613 CCTTTGGAAGAATTTAGAGCCAC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1038417463 8:27407629-27407651 CCCGGGAGGTGGGTCTCCCCAGG No data
1038417456_1038417463 -4 Left 1038417456 8:27407610-27407632 CCACTACTGGACAGGTGCTCCCG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1038417463 8:27407629-27407651 CCCGGGAGGTGGGTCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038417463 Original CRISPR CCCGGGAGGTGGGTCTCCCC AGG Intronic
No off target data available for this crispr