ID: 1038424812

View in Genome Browser
Species Human (GRCh38)
Location 8:27458326-27458348
Sequence TCTTGTTGATGAGCTCTGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038424812_1038424819 30 Left 1038424812 8:27458326-27458348 CCTGGCAGAGCTCATCAACAAGA 0: 1
1: 0
2: 3
3: 14
4: 135
Right 1038424819 8:27458379-27458401 CCCTAAGTGAGGAGTGCAAGAGG 0: 1
1: 0
2: 0
3: 15
4: 121
1038424812_1038424815 19 Left 1038424812 8:27458326-27458348 CCTGGCAGAGCTCATCAACAAGA 0: 1
1: 0
2: 3
3: 14
4: 135
Right 1038424815 8:27458368-27458390 CGCCGTGACCTCCCTAAGTGAGG 0: 1
1: 0
2: 11
3: 188
4: 927

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038424812 Original CRISPR TCTTGTTGATGAGCTCTGCC AGG (reversed) Exonic
906917917 1:50031450-50031472 TTTTGTTGAAGACCTCTTCCAGG - Intergenic
907703799 1:56815437-56815459 TCTAGTTGTTCAGCTTTGCCGGG - Intronic
907805026 1:57810275-57810297 GCCTGTTGATGAACTCTTCCTGG + Intronic
908981073 1:69959948-69959970 TGTTGTTGTTGTTCTCTGCCAGG + Intronic
909931249 1:81502564-81502586 TCTTGTTGATGATCTCCACCAGG - Intronic
913078843 1:115363504-115363526 TCTTGTTTCTGACATCTGCCTGG + Intergenic
917248253 1:173028222-173028244 TGTTGTTGTTGTGCTCTGCCAGG + Intergenic
918052920 1:180990423-180990445 TCTTGTAAAAGAGCTCTTCCTGG + Intronic
919628681 1:199937934-199937956 TTCTGTTAATGCGCTCTGCCTGG + Intergenic
923348926 1:233084890-233084912 CTGTCTTGATGAGCTCTGCCTGG - Intronic
924688311 1:246319585-246319607 TTTTGTTGATGAGCTCTGTTGGG - Intronic
1064890527 10:20166452-20166474 TCTTATTTAAGAGCTCTGTCAGG - Intronic
1065478579 10:26168121-26168143 CCTTGTTAATGAAATCTGCCTGG + Intronic
1067076587 10:43190100-43190122 TTTTCTTGATCAGCTTTGCCAGG + Intergenic
1067508219 10:46874289-46874311 TTTGGTTTCTGAGCTCTGCCTGG + Intergenic
1067654032 10:48177556-48177578 TTTGGTTTCTGAGCTCTGCCTGG - Intronic
1068269553 10:54702884-54702906 TATTGTTGTTGTGTTCTGCCAGG - Intronic
1068285338 10:54926415-54926437 TGTTGTTGTTGTACTCTGCCTGG + Intronic
1068324072 10:55460924-55460946 ACTTATTGATGAGCACTGCATGG - Intronic
1068561800 10:58523232-58523254 TTTTTTTGTTGTGCTCTGCCAGG - Intronic
1068656512 10:59581655-59581677 TCTTGATGATGAGAATTGCCTGG + Intergenic
1070618858 10:77991039-77991061 TCCTGCAGGTGAGCTCTGCCAGG - Exonic
1070942236 10:80357592-80357614 TCTTGCTGGTGACCTCTGCTTGG + Intronic
1071884410 10:89933996-89934018 TTTTTTTGTTGTGCTCTGCCAGG + Intergenic
1073115824 10:101091036-101091058 TCATGTTGAGGGCCTCTGCCTGG - Intronic
1073304648 10:102493362-102493384 TCTTGTTTTTAACCTCTGCCGGG - Intronic
1073986186 10:109212164-109212186 TCTACTTGATGAGCTCAGCTAGG - Intergenic
1075796927 10:125127264-125127286 GGTTGTTGATGAGCACTGCAAGG - Intronic
1075876180 10:125807730-125807752 TCTTGTAGATGAGCTATGTGGGG - Intronic
1078401096 11:11028068-11028090 TGTTGCTGATGAGATCTCCCAGG + Intergenic
1078512234 11:11994042-11994064 TCTGAGTGATGTGCTCTGCCAGG - Intronic
1081931693 11:46875878-46875900 TGTTGTTGATGAGCACCGCGCGG + Exonic
1084171998 11:67405319-67405341 GCCTGCTGATGAGCTGTGCCTGG + Intronic
1084358939 11:68657246-68657268 TTCTCATGATGAGCTCTGCCAGG - Intergenic
1086358754 11:86035272-86035294 TAAAGTTGATGAACTCTGCCTGG - Intronic
1091521622 12:1250285-1250307 TTTTGTTGATGAACTCTGCCTGG + Intronic
1091753617 12:3037964-3037986 TGTTGGTGTTGAGGTCTGCCTGG - Exonic
1094424213 12:30301910-30301932 TCTTGCTGATGGGCCCTGACAGG - Intergenic
1094475750 12:30839450-30839472 TCATGTTGATGAGCCCTGAGGGG - Intergenic
1095735257 12:45548952-45548974 TCTGGTTAATTAGCACTGCCTGG - Intergenic
1100207812 12:92369974-92369996 TCCTGTTGGTGGGCTCTGCTGGG + Intergenic
1101879716 12:108617896-108617918 TTTTGTTGATTAGCTCTCACGGG - Intergenic
1101958845 12:109232990-109233012 TGTTATTGATGTGCTGTGCCAGG - Intronic
1102189114 12:110972919-110972941 ACTTCTTGGTGTGCTCTGCCTGG + Intergenic
1109216380 13:59594312-59594334 TTTTTTTGTTGTGCTCTGCCAGG - Intergenic
1113832909 13:113310951-113310973 TCCTGGTGCTGGGCTCTGCCTGG + Intronic
1114457442 14:22865308-22865330 TCTAGTTGGTGAACTATGCCAGG + Intergenic
1114459799 14:22879084-22879106 GCTGGGTGATGGGCTCTGCCAGG - Exonic
1114741831 14:25105298-25105320 TCATATGGGTGAGCTCTGCCTGG + Intergenic
1116968756 14:51042762-51042784 CCTTCTTCATGAGCTTTGCCAGG + Intronic
1120825721 14:88953172-88953194 TGTTCTTGATAAGCTCTGCAGGG - Intergenic
1121127210 14:91416082-91416104 TCCTGTTGCTGAGCTCTGCACGG - Intronic
1124874233 15:33576297-33576319 TCTTTTTGTTCATCTCTGCCAGG - Intronic
1129294040 15:74589905-74589927 TCTTGTTGATGATCTCCACCAGG - Exonic
1132287622 15:100676030-100676052 TTTTTTTGTTGTGCTCTGCCAGG + Intergenic
1134270820 16:12731544-12731566 TCCTGTTGGAGGGCTCTGCCTGG - Intronic
1135287961 16:21210315-21210337 ACTTGTTTGTGAGCTCTCCCAGG - Intronic
1140811476 16:78583067-78583089 TCTTCTTCAAGAGCTCTGCTCGG - Intronic
1141646649 16:85371226-85371248 TCTGGTCCATGAGCACTGCCTGG - Intergenic
1142772679 17:2110681-2110703 TGTTGTTGCTGACCTCTCCCAGG - Intronic
1147659553 17:42110218-42110240 GCTTGTTAATGCGCTCTGCAAGG - Intronic
1151492378 17:74440268-74440290 TATTGATGATGACCTCTACCAGG - Exonic
1151990618 17:77571728-77571750 TCGTGTTTATGAACTGTGCCTGG + Intergenic
1153537009 18:6113007-6113029 TAGTGTTAATGAGCTGTGCCTGG + Intronic
1157801433 18:50624797-50624819 TCTTCTTGGTGGGCCCTGCCTGG + Intronic
1159175331 18:64826500-64826522 GCTTGTTGAAGAACTCTGCATGG - Intergenic
1160800252 19:964333-964355 TCTTGTTGATGACCTCCACGAGG - Exonic
1161046078 19:2135777-2135799 TCTTGCTGATGGGCTCGGCACGG - Intronic
1162805550 19:13136314-13136336 TCTGGTTGATAAGTTCAGCCGGG - Exonic
1165130839 19:33630924-33630946 TCCTGTGGCTGAGCTCAGCCTGG + Intronic
1165822698 19:38686619-38686641 TCCTGGTGAGAAGCTCTGCCTGG + Intronic
925997856 2:9306641-9306663 TCGGGTTGATGAGCCCAGCCAGG + Intronic
930850920 2:55959363-55959385 TCTTGGTTTAGAGCTCTGCCAGG - Intergenic
931603586 2:64029384-64029406 GCTTGTTGTAGAGCTCTGCAGGG - Intergenic
933201841 2:79460141-79460163 TCTTGTTGAATATCTCTACCTGG + Intronic
933292629 2:80454676-80454698 TCTTGCTTATTAGTTCTGCCGGG + Intronic
933938238 2:87224409-87224431 TCTTGTGGATGAAATCTTCCAGG + Intergenic
938243933 2:129763184-129763206 TCATGCTGCTGAGCTCTTCCTGG - Intergenic
941578864 2:167269407-167269429 TCTTGTGGATGAGACCTGCTGGG + Intergenic
941630021 2:167874164-167874186 TCTTGGGGATGAGCTCTGAATGG - Intergenic
943955332 2:194181389-194181411 TTTTGTTGATGAGCTGGGCGTGG + Intergenic
946563361 2:220937692-220937714 GCTAGTTGGTGAGTTCTGCCAGG + Intergenic
947622631 2:231600690-231600712 TCTTTTTGGTGTGTTCTGCCAGG + Intergenic
948143342 2:235690618-235690640 TCTGCTTGAGGAGCTCTGACGGG + Intronic
1169135506 20:3194835-3194857 TGTAGTTGATGAACTCTGTCAGG + Exonic
1169530177 20:6476651-6476673 TCTTGATGATGAGCTTTCTCTGG + Intergenic
1170649265 20:18225082-18225104 TCTTGTTGTTGAGCACAGCCTGG + Intergenic
1171069980 20:22059131-22059153 TCTTGTCCTTGTGCTCTGCCAGG + Intergenic
1178412309 21:32375220-32375242 TCTTGTTGATGAGCATATCCTGG - Intronic
1180637012 22:17269520-17269542 TTTGGCTGAAGAGCTCTGCCAGG - Intergenic
1184208049 22:43017673-43017695 TCTTGTTGCTGGGCAGTGCCAGG - Intergenic
949159981 3:869881-869903 TCTTGTTGAAGAGCTTTCTCTGG - Intergenic
951130675 3:19039629-19039651 TGTTGTTCTTGTGCTCTGCCAGG + Intergenic
952086795 3:29832537-29832559 TCTTGTCACTGAGCTATGCCCGG - Intronic
952167017 3:30761283-30761305 GCTTGTTGAGGAGCTCTGAGAGG - Intronic
952856953 3:37779774-37779796 TCTTGTGGATTTCCTCTGCCTGG + Intronic
954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG + Intronic
954327957 3:49873814-49873836 TCTGGTTGATCAGTCCTGCCTGG + Intergenic
956987647 3:74721484-74721506 TCTTGTTGATATTCTCTACCTGG + Intergenic
958083385 3:88775074-88775096 TGTTGGTGATGAATTCTGCCAGG - Intergenic
959650837 3:108749297-108749319 TCTAGTTGGTGAGCTCTGTAAGG + Intronic
969099093 4:4755518-4755540 TCCTGTTCAGCAGCTCTGCCTGG + Intergenic
969271504 4:6106284-6106306 TCTTGGTGATGATTTCTGCAGGG - Intronic
972843553 4:42959952-42959974 TGTTGAGGATGAGCTTTGCCTGG - Intronic
976778116 4:88728559-88728581 TCTTGCTGATGAGCACCTCCAGG + Exonic
978573553 4:110166031-110166053 TTTTGTTGATAAGCTGTCCCAGG - Intronic
979801418 4:124913846-124913868 TCCTGTTTATGAGTTCTGCCAGG - Intergenic
982372638 4:154650525-154650547 TTTTTTTGTTGATCTCTGCCAGG - Intronic
983279641 4:165664432-165664454 TCTTGTTGAAGACGTATGCCAGG + Intergenic
990397701 5:55400565-55400587 TCTTGCTGATGAGAGCTGACAGG - Intronic
995614346 5:113944246-113944268 TCTTGGCAATGAGCTGTGCCAGG - Intergenic
995931110 5:117445927-117445949 TCTGTTTGATGTGCTTTGCCGGG + Intergenic
996471907 5:123871130-123871152 TTTTCTTGATGAGCTGTGGCAGG - Intergenic
1001241987 5:170078119-170078141 GCTTGGTGAGGAGCTCTGCCTGG - Intronic
1002212515 5:177607308-177607330 CCACGTTGATGAGCGCTGCCCGG - Exonic
1004192924 6:13480075-13480097 TCATGTTGAAGAGGGCTGCCAGG - Intronic
1005450454 6:25966903-25966925 TCTTGTTGAAGACGTATGCCAGG + Exonic
1005926085 6:30446940-30446962 GCTTGTTGATGAACTCTGTTGGG + Intergenic
1005975011 6:30791181-30791203 CCTTGCTAATGAGCTCTGCCAGG - Intergenic
1006310037 6:33250885-33250907 GAATGTTGATGAGCTCAGCCCGG + Exonic
1006375147 6:33667893-33667915 TCTTGGTGATGTGCTTTTCCAGG - Exonic
1006579198 6:35066890-35066912 TTTTGTTCATCTGCTCTGCCAGG - Intronic
1010467248 6:76183068-76183090 TCTTGGTAATCAGCGCTGCCTGG + Intergenic
1011323736 6:86126044-86126066 TCTTGAATATGAGCTGTGCCTGG - Intergenic
1013182530 6:107730399-107730421 TCTTGTTGATGAGCAGTGCCAGG - Intronic
1013649095 6:112175466-112175488 TCTTGTTGTTGATCTCTGAAAGG + Exonic
1019427484 7:984366-984388 TCTTGTGGGTGAGGGCTGCCCGG + Intronic
1021130252 7:16902879-16902901 TCTTGTTGATCAGCTCCTGCTGG + Intergenic
1024457350 7:49624742-49624764 TATTGTTAATGAGCTCTCCTTGG + Intergenic
1025738399 7:64174883-64174905 TCTTGCTCAGGAGCTCTGACAGG - Intronic
1028280726 7:88924625-88924647 TCTTGTGGAAGAGCTTTCCCAGG - Intronic
1030937703 7:115606140-115606162 TCTTTTTCATGACCTCTGCCAGG - Intergenic
1032555211 7:132825751-132825773 TCTTGTTCAAGAGCTCTGCTTGG + Intronic
1032790721 7:135240650-135240672 GGTTGTTGAAGAGCGCTGCCAGG - Exonic
1034000459 7:147407005-147407027 TCTTGTTGATGAAGCCTGTCTGG - Intronic
1035003558 7:155637352-155637374 TCTTGTTCATGAACTCCACCAGG - Intronic
1038022503 8:23562135-23562157 TCTTGGGGATGAGCCCTGGCTGG - Intronic
1038424812 8:27458326-27458348 TCTTGTTGATGAGCTCTGCCAGG - Exonic
1040389517 8:46937791-46937813 TCTTCTTGATGTGCTCTTACTGG + Intergenic
1047362876 8:124184961-124184983 TCTTGTTGAAGGACTCTGACTGG - Intergenic
1049112845 8:140659624-140659646 TCTTGTTGATGAGCTCACCCAGG + Exonic
1049992738 9:1005365-1005387 CCCTGATGATGAGCTCTGCCAGG + Intergenic
1050687313 9:8186330-8186352 TCTTGGTGATAAGCTCTGGCTGG - Intergenic
1055484291 9:76742111-76742133 TGTTTTTAATAAGCTCTGCCAGG - Intronic
1059088168 9:111327428-111327450 TTTCTCTGATGAGCTCTGCCAGG + Intergenic
1059495557 9:114706237-114706259 TCTTGGTTATAAGCTCTGCTTGG + Intergenic
1061997143 9:134192365-134192387 GCTTTCAGATGAGCTCTGCCCGG - Intergenic
1062166955 9:135112701-135112723 CCTTGCTGCTGAGCTCTCCCAGG - Intronic
1185861100 X:3580399-3580421 TCATGTTGATAAGCTCTGGATGG + Intergenic
1189635580 X:43004939-43004961 TCTTGTTGAAGGGCCCTGCCTGG + Intergenic
1189817035 X:44834492-44834514 ACTTGTTGCTGGGCTCAGCCTGG - Intergenic
1200127956 X:153825897-153825919 TCTTGTTAATTTGCTCTGGCTGG - Intronic
1201244626 Y:11991080-11991102 TTTTTTTGTTGTGCTCTGCCTGG + Intergenic