ID: 1038425179

View in Genome Browser
Species Human (GRCh38)
Location 8:27460150-27460172
Sequence GGGTTCTCGGGACAGCATGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038425179_1038425188 22 Left 1038425179 8:27460150-27460172 CCTCCATGCTGTCCCGAGAACCC 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1038425188 8:27460195-27460217 CAATGTCCCACCCTCCAGTCTGG 0: 1
1: 0
2: 0
3: 16
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038425179 Original CRISPR GGGTTCTCGGGACAGCATGG AGG (reversed) Exonic