ID: 1038425466

View in Genome Browser
Species Human (GRCh38)
Location 8:27461510-27461532
Sequence AGGTGCCTCTCCGCGGAGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 74}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038425466_1038425470 -7 Left 1038425466 8:27461510-27461532 CCAGACTCCGCGGAGAGGCACCT 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1038425470 8:27461526-27461548 GGCACCTGCTCATCCCAAAGGGG 0: 1
1: 0
2: 2
3: 23
4: 137
1038425466_1038425472 3 Left 1038425466 8:27461510-27461532 CCAGACTCCGCGGAGAGGCACCT 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1038425472 8:27461536-27461558 CATCCCAAAGGGGACACCAGAGG 0: 1
1: 0
2: 2
3: 7
4: 130
1038425466_1038425476 21 Left 1038425466 8:27461510-27461532 CCAGACTCCGCGGAGAGGCACCT 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1038425476 8:27461554-27461576 AGAGGCAGCTGTAGCAGAGACGG 0: 1
1: 1
2: 2
3: 58
4: 454
1038425466_1038425469 -8 Left 1038425466 8:27461510-27461532 CCAGACTCCGCGGAGAGGCACCT 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1038425469 8:27461525-27461547 AGGCACCTGCTCATCCCAAAGGG 0: 1
1: 0
2: 0
3: 10
4: 156
1038425466_1038425468 -9 Left 1038425466 8:27461510-27461532 CCAGACTCCGCGGAGAGGCACCT 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1038425468 8:27461524-27461546 GAGGCACCTGCTCATCCCAAAGG 0: 1
1: 0
2: 3
3: 19
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038425466 Original CRISPR AGGTGCCTCTCCGCGGAGTC TGG (reversed) Exonic
901869643 1:12130464-12130486 AGCTGCCTCTCCAAGGAGCCCGG + Intronic
902336882 1:15759033-15759055 TGGTCTCTCTCCCCGGAGTCGGG + Intronic
904027878 1:27516033-27516055 AGGTGCCTCCCCATGGAGTGAGG - Intergenic
904334091 1:29785799-29785821 AGGTGACTCTCGGCGGGGGCGGG - Intergenic
905198988 1:36303852-36303874 AGGAGCCTTTCCTCGGGGTCGGG + Exonic
906876166 1:49541557-49541579 AGCTGCCTCTCCGCGGGGCAGGG + Intronic
907401814 1:54229073-54229095 AGGTGCCTCTGTGTGGAGTTGGG - Intronic
907925395 1:58951110-58951132 AGGTGACTATCCTCGGAGTTTGG - Intergenic
915748204 1:158181304-158181326 CGCTGCCTCTCCCCGGAGCCAGG - Intronic
1063660956 10:8034871-8034893 AGGTGGCTTTCTGCGGAGCCAGG + Intergenic
1071302254 10:84264824-84264846 TAGTGCCTCTCCGCAGAGCCTGG + Intergenic
1074855039 10:117467184-117467206 AGGTGCCTCTCCACTGTGTTGGG - Intergenic
1076173172 10:128340273-128340295 AGGTGCCTGTGCGAGGAGTGTGG + Intergenic
1076726385 10:132416113-132416135 AGTGGCCTCTCCGCGGGGCCGGG + Intronic
1076863157 10:133151747-133151769 AGCTGCCTGTCCTCTGAGTCAGG - Intergenic
1085850106 11:80109866-80109888 AGGTGCCCCTCCCCTGAGCCAGG - Intergenic
1086087590 11:82970896-82970918 AGCTGCCTCCCCGCGGGGTAGGG + Intergenic
1086508331 11:87528806-87528828 AGGTGCCTCTCAGCACAGACTGG - Intergenic
1090824464 11:130374533-130374555 AGCTGCCTCTCGGCTGAGGCAGG + Intergenic
1100142362 12:91634164-91634186 AGGTGCCTCCCCGCGGGGCAGGG + Intergenic
1104954295 12:132456940-132456962 AGGTGCCTCTGCGTGGAGAAGGG + Intergenic
1106543794 13:30713543-30713565 AGCTGCCCCTCCCTGGAGTCCGG - Intronic
1109124904 13:58505567-58505589 AGCTGCCTCCCCGCGGAGCAGGG - Intergenic
1117135503 14:52730710-52730732 CGCTGCCCCTCCGCGGGGTCTGG - Intronic
1126639693 15:50812192-50812214 AGCTGCCTCCCCGCGGGGCCAGG + Intergenic
1129986926 15:79926335-79926357 AGGTGCCTCCCCGCGGGGCAGGG + Intergenic
1140200333 16:72889730-72889752 AGGTGCCCCTCCACGGACCCAGG - Exonic
1140758260 16:78088481-78088503 AGGTGCCTTTCTGGGGACTCTGG + Intergenic
1141670763 16:85490591-85490613 GGGTGCCTCTCTGCGGTGACCGG - Intergenic
1142148778 16:88503583-88503605 AGCTGCCTCTCTGTGGAGCCAGG + Intronic
1142339027 16:89508599-89508621 AGGTAAATCCCCGCGGAGTCCGG + Exonic
1144128101 17:12221085-12221107 AGGTGCCTCCCCGCGGGGCAGGG + Intergenic
1154500222 18:14992363-14992385 AGGTGCCTTGCCGGGAAGTCAGG + Intergenic
1160453569 18:78980574-78980596 TGGCTCCTCTCCTCGGAGTCGGG + Intronic
1161393056 19:4031355-4031377 AGGGGTCCCTCCACGGAGTCCGG + Intronic
930420865 2:51151755-51151777 AGCTGCCTCCCCGCGGGGTGGGG - Intergenic
934770301 2:96903500-96903522 AGGTGCCTGTCCTGGGAGCCTGG - Intronic
942182592 2:173394733-173394755 ATGTGCCTCTCCACGGAGCCAGG + Intergenic
943520602 2:188944572-188944594 AGCTGCCTCCCCACGGAGCCGGG - Intergenic
946360168 2:219214614-219214636 AGGTGCCTCCCTGTGGAATCTGG - Intronic
946427475 2:219606895-219606917 GGGTGTCTCTCCGGGGACTCTGG + Intronic
947571811 2:231241821-231241843 AGCTGCCTCTCCGGAGAGGCAGG + Intronic
949078547 2:242077748-242077770 AGCTGCCACTCCGCAGACTCAGG - Intergenic
1179574656 21:42300182-42300204 AGGTACCTCTCCGTGGAGAGGGG + Intergenic
1182338017 22:29598203-29598225 AGCTGCCCCTCCGCGGAGAAGGG - Intergenic
1184639098 22:45859572-45859594 ATGTGCCTCTCTAAGGAGTCTGG - Intergenic
950210650 3:11120507-11120529 AGGTGCCTCCCCGCTGAGGCTGG + Intergenic
954397389 3:50299921-50299943 TGGTGCCTCTCAGCAGATTCAGG + Exonic
956797284 3:72728386-72728408 AGATGCCCCTCAGAGGAGTCAGG - Intergenic
961003303 3:123388527-123388549 AGGTGCATCTCCGGAGAGGCTGG + Intronic
963673493 3:148280700-148280722 AGCTGCCTCCCCGCGGGGTACGG - Intergenic
964641211 3:158912222-158912244 AGGTGACTCCCTGGGGAGTCAGG + Intergenic
966372409 3:179263189-179263211 AGGTGCCTCCCCGCGGGGCAGGG - Intronic
966849343 3:184155288-184155310 CGGCGCCTCTCCGCGGCGGCCGG + Intronic
968870101 4:3237573-3237595 AGGTGCCTCCCTGTGGCGTCTGG - Intronic
970615736 4:17766943-17766965 AGGTGCCTCCCCGCGGGGCAGGG - Intronic
973149220 4:46866406-46866428 AGGTAGCTCTCCAGGGAGTCAGG - Intronic
975353274 4:73369684-73369706 AGCTGCTTCTCCCAGGAGTCGGG - Intergenic
994251491 5:97542016-97542038 AGCTGCCTCACCGCGGGGGCAGG - Intergenic
995529152 5:113075260-113075282 AGCTGCCTCCCCGCGGAGCAGGG + Intronic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998342528 5:141430987-141431009 AGCTGCCGCTGCGCGGATTCAGG - Exonic
999192963 5:149762483-149762505 AGGTACCTCTCTGCTGATTCCGG + Intronic
1000609159 5:163356039-163356061 AGCTGCCTCTCCGCGGGGCAGGG + Intergenic
1002634011 5:180598307-180598329 TGCTGCCTCTCCGTGGAGACTGG + Intergenic
1004217606 6:13716976-13716998 AGCTGCCTCTCCGCGGGGCAGGG + Intergenic
1020375328 7:7478680-7478702 AGCTGCCTCTCCGCGGGGCAGGG - Intronic
1031146601 7:118003818-118003840 GGGTGCCTCTCCATGGAGGCAGG - Intergenic
1032446633 7:131989841-131989863 AGGGGCCTTTCCTTGGAGTCAGG - Intergenic
1035159040 7:156937795-156937817 CGGTTCCTCTCCCCGGAGTTTGG - Intergenic
1038019353 8:23539834-23539856 AGGTGCCACTCCAGGCAGTCTGG - Intronic
1038425466 8:27461510-27461532 AGGTGCCTCTCCGCGGAGTCTGG - Exonic
1053126602 9:35585909-35585931 AGGTGACTCCCCAGGGAGTCAGG - Intergenic
1056216296 9:84408702-84408724 AGCTGCCTCCCCGCGGGGCCGGG + Intergenic
1061416408 9:130449479-130449501 AGGTGCCTCTGGGAGGAGGCAGG + Intronic
1062037331 9:134388624-134388646 AGGAGCCTCTCCTGTGAGTCAGG + Intronic
1189465570 X:41275810-41275832 AGGTGGCTCCCCGGGGAGGCTGG - Intergenic