ID: 1038425523

View in Genome Browser
Species Human (GRCh38)
Location 8:27461810-27461832
Sequence GTGCAGGGGCTGTGAATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 341}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038425523_1038425530 -10 Left 1038425523 8:27461810-27461832 CCCCCCATTCACAGCCCCTGCAC 0: 1
1: 0
2: 4
3: 26
4: 341
Right 1038425530 8:27461823-27461845 GCCCCTGCACAGGCGGCCACTGG 0: 1
1: 0
2: 0
3: 17
4: 193
1038425523_1038425540 24 Left 1038425523 8:27461810-27461832 CCCCCCATTCACAGCCCCTGCAC 0: 1
1: 0
2: 4
3: 26
4: 341
Right 1038425540 8:27461857-27461879 ACTGCCCCACAGAGACCTTGGGG 0: 1
1: 0
2: 0
3: 17
4: 177
1038425523_1038425539 23 Left 1038425523 8:27461810-27461832 CCCCCCATTCACAGCCCCTGCAC 0: 1
1: 0
2: 4
3: 26
4: 341
Right 1038425539 8:27461856-27461878 AACTGCCCCACAGAGACCTTGGG 0: 1
1: 0
2: 0
3: 10
4: 159
1038425523_1038425538 22 Left 1038425523 8:27461810-27461832 CCCCCCATTCACAGCCCCTGCAC 0: 1
1: 0
2: 4
3: 26
4: 341
Right 1038425538 8:27461855-27461877 CAACTGCCCCACAGAGACCTTGG 0: 1
1: 0
2: 0
3: 19
4: 196
1038425523_1038425536 -7 Left 1038425523 8:27461810-27461832 CCCCCCATTCACAGCCCCTGCAC 0: 1
1: 0
2: 4
3: 26
4: 341
Right 1038425536 8:27461826-27461848 CCTGCACAGGCGGCCACTGGGGG 0: 1
1: 0
2: 6
3: 19
4: 177
1038425523_1038425534 -8 Left 1038425523 8:27461810-27461832 CCCCCCATTCACAGCCCCTGCAC 0: 1
1: 0
2: 4
3: 26
4: 341
Right 1038425534 8:27461825-27461847 CCCTGCACAGGCGGCCACTGGGG 0: 1
1: 0
2: 3
3: 21
4: 235
1038425523_1038425532 -9 Left 1038425523 8:27461810-27461832 CCCCCCATTCACAGCCCCTGCAC 0: 1
1: 0
2: 4
3: 26
4: 341
Right 1038425532 8:27461824-27461846 CCCCTGCACAGGCGGCCACTGGG 0: 1
1: 0
2: 2
3: 13
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038425523 Original CRISPR GTGCAGGGGCTGTGAATGGG GGG (reversed) Intronic
900208449 1:1441420-1441442 GTGCAGGGGGTGTCTGTGGGGGG + Exonic
901185147 1:7368126-7368148 GTGCAGGCGCTGGGCATGGATGG + Intronic
902336694 1:15758533-15758555 GGCCAGGGGGTGGGAATGGGGGG - Intronic
902785575 1:18730761-18730783 GAGCAGAGGCTGTGGAAGGGGGG + Intronic
902815929 1:18916833-18916855 GCACAGGGGCGGTGAATGGGAGG - Intronic
903069261 1:20718410-20718432 GTCCAGGGGCTGTGGGTGGTGGG - Intergenic
903267007 1:22163591-22163613 GGGCAGGGGCTGGGGAGGGGTGG + Intergenic
903441642 1:23392778-23392800 GTGTGGGGGCTGTGTATGTGTGG - Intronic
903761928 1:25704350-25704372 GTACAGATGCTGGGAATGGGCGG + Intronic
903909117 1:26709366-26709388 GTGCAGGGGAGGAGAATGTGAGG - Intronic
903969023 1:27107142-27107164 GTGGAGGGGCTGTGAGGGTGTGG - Intronic
903969031 1:27107171-27107193 GTGGAGGGGCTGTGAGGGTGTGG - Intronic
904129245 1:28263370-28263392 GTGGAGGGGGTGTGAGTGAGTGG - Intronic
904809930 1:33156922-33156944 GTGGAGGGGGTGGGAAGGGGTGG - Intronic
904912865 1:33948411-33948433 GTAAAGGGGATGTGAATGGATGG - Intronic
906520167 1:46462052-46462074 GGGCAGGGACAGTGAAAGGGAGG - Intergenic
907359753 1:53904947-53904969 GTGCAGGGCCTGGGAGTGGTGGG - Intronic
909618287 1:77637542-77637564 GTGCAGGGGCAGGGAAGTGGGGG + Intronic
909817827 1:80018636-80018658 ATGAAGGAGCTGAGAATGGGGGG - Intergenic
909854446 1:80510826-80510848 GGGAAGGGGCTCTGATTGGGTGG - Intergenic
910394028 1:86774103-86774125 GTGCAGGGGTTGGGAAAGGATGG - Intergenic
911536019 1:99101743-99101765 GTCCAGGAGTTGTGATTGGGTGG + Intergenic
912212741 1:107572393-107572415 GTGCGGGGGAGGTGGATGGGAGG + Exonic
912446352 1:109739944-109739966 GGGCGGGGGTTGGGAATGGGTGG - Intronic
912465476 1:109869978-109870000 GTGGAGGGGTTGTGTATGTGAGG + Intergenic
915993420 1:160540421-160540443 GTGCAGGGCCTCTGAATGTTTGG - Intergenic
916419064 1:164619442-164619464 GTGAAGGGGCAGTGAGTGAGGGG + Intronic
916572350 1:166038851-166038873 GAGCAGGGGCGGGGCATGGGTGG - Intergenic
916975767 1:170075659-170075681 GTGTAGCTGGTGTGAATGGGTGG - Intronic
918237158 1:182591863-182591885 GGGCAGGGGCTGGGCATGGTGGG - Intergenic
919709126 1:200708826-200708848 GTCTAGGGCCTGTGAATGTGGGG + Intergenic
921739521 1:218667937-218667959 GTGCAGGGGGTGTTTATGGCAGG + Intergenic
922060553 1:222086758-222086780 ATGCAGGTGCTGGGGATGGGTGG + Intergenic
922201784 1:223409212-223409234 TTTCAGGGACTGTAAATGGGTGG + Intergenic
923497945 1:234541138-234541160 GTGCTGGGGTTGGGGATGGGGGG + Intergenic
1062831388 10:608259-608281 GTGTAGGGGCTGTGTGTGGGGGG - Intronic
1064159510 10:12931827-12931849 ATGCAGGGGCTCTGAATCTGGGG + Intronic
1065522167 10:26583788-26583810 GGGCAGGGCCTCTGAAAGGGCGG + Intergenic
1067048946 10:43001105-43001127 GTGCAGGGGGAGGGAAGGGGAGG - Intergenic
1067338516 10:45382778-45382800 GTGCAGGGGCGGGAAGTGGGAGG + Intronic
1067477384 10:46575992-46576014 GTGGGGGGGATGAGAATGGGAGG + Intergenic
1067568043 10:47352134-47352156 GTGCAGGCGCTTTGTCTGGGAGG + Intronic
1067617356 10:47765792-47765814 GTGGGGGGGATGAGAATGGGAGG - Intergenic
1069404930 10:68088917-68088939 TTCCTGGGGCTGTGAGTGGGAGG - Intergenic
1069900007 10:71701812-71701834 GGGGAGGGGCTGGGAATGGCTGG - Intronic
1071333795 10:84585652-84585674 GAGCAGTGCCTGTGACTGGGTGG - Intergenic
1071409786 10:85377816-85377838 GTGCAGGGCTTGTCAAAGGGAGG + Intergenic
1071735675 10:88296828-88296850 TAGCAGGGGCTGTGATTGAGAGG - Intronic
1073946824 10:108760468-108760490 CTGTAGGAGCTGTGAGTGGGAGG - Intergenic
1074711219 10:116179132-116179154 GTGCTGAGGCTGTGATTGGCTGG - Intronic
1076054609 10:127361697-127361719 GAGCAGGGGCTGCGAGTCGGGGG - Intronic
1076109713 10:127851243-127851265 GGGGAGAGGCTGTGACTGGGAGG + Intergenic
1076139434 10:128068007-128068029 GTGCTGGGGCTGCGTAGGGGAGG - Intronic
1076207567 10:128615293-128615315 CTGCAGGGGCTGGGAAAGTGAGG + Intergenic
1076740089 10:132478608-132478630 GTGCTGGGGCTGCCAAAGGGAGG - Intergenic
1076848618 10:133082229-133082251 GGGCAGGGGCTGTGAGGGGCAGG - Intronic
1077211394 11:1372380-1372402 GTGCAGTGGCTGGGACAGGGCGG - Intergenic
1077524851 11:3057780-3057802 GAGCAGGGCCTGGGGATGGGCGG + Intergenic
1078330328 11:10414016-10414038 GGGCAGGGGCAGTGGATGTGGGG + Intronic
1078930235 11:15906792-15906814 GTGGAGGGGCTGTGGGTCGGCGG - Intergenic
1079849276 11:25510638-25510660 TTTCAGGGTCTGTGAGTGGGTGG - Intergenic
1080049600 11:27846062-27846084 GTGCAGGGGAAAGGAATGGGAGG - Intergenic
1080666045 11:34337254-34337276 ATGCAGGGGCTGTGTAGGGAAGG + Intronic
1081636154 11:44723627-44723649 GTGGTGGGGCTGTGGATGGATGG - Intergenic
1081810787 11:45913185-45913207 GTGCAGTGGCTGGGACTGTGAGG - Intronic
1082971947 11:59031939-59031961 GGGCAGGGAGTGTGAATAGGAGG - Intronic
1083727326 11:64635377-64635399 GTGCTGGGCCTGTCATTGGGGGG + Exonic
1083764854 11:64836809-64836831 GTGCAGGGCCTCTGGAGGGGAGG + Exonic
1083990528 11:66243461-66243483 GAGGAGGGGCTGTGCAGGGGTGG - Exonic
1084933548 11:72575178-72575200 CAGCAGGAGCTGGGAATGGGAGG + Intergenic
1084955327 11:72688333-72688355 GTGCAGGGGCTCTGATGGTGTGG - Intronic
1086928905 11:92670968-92670990 ATGCAGGGGCTTTGAATGTCAGG - Intronic
1088626014 11:111731265-111731287 GGGCAGGGGCTGGAAATGGGAGG + Intronic
1089632900 11:119794521-119794543 GTGGAGGGGCTCTGCAAGGGAGG + Intergenic
1090090181 11:123689697-123689719 GTGCAGAGGCTGAGAATTGCTGG - Intergenic
1090568481 11:128021613-128021635 GTACTGGGGCTGTGAAAGGCTGG + Intergenic
1091023113 11:132118929-132118951 GTGAAGGGGCTGGGAGGGGGAGG + Intronic
1091219928 11:133924467-133924489 GGGGAGGGGCTGTGAATCGGAGG - Intronic
1091533443 12:1382939-1382961 GTCCAGAGGCTGGGAATGTGGGG + Intronic
1093102699 12:15047137-15047159 GTGTAGGGGCTGGGAGTTGGTGG - Intergenic
1094073397 12:26445337-26445359 GTGCTGGAGCTGTGCATGGAGGG + Intronic
1096745665 12:53725334-53725356 TGGCAGGGGCTGTGAGTGTGTGG - Intronic
1102229357 12:111251827-111251849 GTGCAGGGGATGTTCATGTGAGG + Intronic
1104039374 12:125119827-125119849 GTGCAGAACCTGTGACTGGGGGG + Intronic
1104150258 12:126075321-126075343 CTCCAGGGGCTGTCAAGGGGTGG - Intergenic
1104356058 12:128088082-128088104 GAGCAGGAGTTGTGAGTGGGAGG - Intergenic
1104390045 12:128384331-128384353 GGGCAGGGGCTCTGGAGGGGTGG + Intronic
1104586351 12:130051073-130051095 GTGAAGGGGCTGTGGAGGGGAGG - Intergenic
1104751943 12:131245471-131245493 GGGCAGGCGCTGGCAATGGGAGG - Intergenic
1104815755 12:131644590-131644612 GTGCATGGGCTGTGAACTGTAGG - Intergenic
1106350889 13:28929789-28929811 GAGCAGGGGCTGTGACTGCCAGG - Intronic
1107008577 13:35643859-35643881 GTGCAGGTCCTGTGAATGGGAGG - Intronic
1107775737 13:43839080-43839102 GTGCAAGGTCTGGTAATGGGCGG + Intronic
1108687880 13:52836543-52836565 GTGCAGTGGTTCTGAAAGGGTGG + Intergenic
1110887186 13:80654890-80654912 CTTCAGTGGCTGTGACTGGGAGG - Intergenic
1111657800 13:91174974-91174996 GGGAAGGGGCTATGAGTGGGTGG - Intergenic
1111774482 13:92642169-92642191 GTGCACTTGCTGTGAATGGTAGG + Intronic
1113494692 13:110717501-110717523 GGGGAGGGGCTGAGAGTGGGAGG - Intronic
1117882789 14:60328188-60328210 CTGCGGGGGCTGTGAAAGGATGG + Intergenic
1118035558 14:61862528-61862550 GTGTAGGGGCAGGGCATGGGTGG - Intergenic
1118604405 14:67492205-67492227 TTGCCGGGGGTGGGAATGGGAGG - Intronic
1119232259 14:72989711-72989733 GTGCAGTGGCTGTGAGAGGCTGG + Intronic
1121586567 14:95067090-95067112 GTGCAGGAGCTGAGATGGGGAGG - Intergenic
1122096573 14:99376772-99376794 GTGCAGTGTGTGTGAATGAGGGG + Intergenic
1122267212 14:100552238-100552260 CTGCAGGTGCAGTGAGTGGGGGG + Intronic
1122363218 14:101179701-101179723 GGGCTGGGGCTGGGGATGGGGGG + Intergenic
1122635657 14:103128491-103128513 GTCCAGGGGCTGTTATTGTGGGG + Intronic
1122816257 14:104315707-104315729 GAGCAGGGGCAGTGGATGGGAGG - Intergenic
1122817420 14:104320604-104320626 GGGAAGGGGCTGTGGGTGGGTGG - Intergenic
1123020621 14:105396229-105396251 GTGGAGGGGCTCTGGCTGGGAGG - Exonic
1124649541 15:31464817-31464839 GTGCAGGGGCCATGAAGGGAAGG - Intergenic
1125355118 15:38809421-38809443 GTCCAGGGGCTTTGCCTGGGTGG + Intergenic
1128341076 15:66822840-66822862 GTACAGGGTCTGGGAGTGGGTGG + Intergenic
1128528457 15:68428410-68428432 GTGGATGGGCTGGGAATGGTGGG + Intronic
1129328219 15:74813078-74813100 CTGGAGGGGCTGTGACTTGGTGG + Intronic
1129660082 15:77548552-77548574 GTGCAGGGGAGGTGAGTGGGGGG - Intergenic
1130353365 15:83109729-83109751 GTGCGTGGGCTGGGACTGGGGGG - Intronic
1131091789 15:89629256-89629278 GTGCAGGGGCTGTGAGTGGCAGG + Intronic
1131179211 15:90228673-90228695 CTTCAGGGGCTGTGAATGCTCGG + Exonic
1131714595 15:95094786-95094808 GTGGAGGGGTGGGGAATGGGAGG - Intergenic
1131766632 15:95683035-95683057 GTTCAGGGGCTATGAAAAGGAGG - Intergenic
1131871969 15:96772837-96772859 GTGCAGGAGCTGTGAATGTGTGG + Intergenic
1132144048 15:99416390-99416412 GAGCAAGGGCTCTGAAGGGGAGG + Intergenic
1132586875 16:709451-709473 GGGCAGGGGCAGTGTGTGGGGGG - Intronic
1132804243 16:1768395-1768417 ATGCAGGGGATGTGGATGGCAGG - Intronic
1132880688 16:2160534-2160556 GGGCAGGCGGTGTGGATGGGCGG + Intronic
1133033200 16:3021309-3021331 CTGCCTGGGCTGTGAGTGGGGGG + Exonic
1133397299 16:5458351-5458373 GTTGAGGGTCTGTGGATGGGTGG + Intergenic
1134402323 16:13920949-13920971 GTGAAGGGGCTCTGAGTGGTAGG + Intronic
1134816200 16:17207804-17207826 GTGGAGGGGATGTGAACTGGGGG + Intronic
1135995466 16:27244544-27244566 GTGAAGGGGCTGAGATGGGGAGG - Intronic
1136554773 16:31001375-31001397 GTGCCGGGGCTGCGGCTGGGCGG + Intronic
1136554799 16:31001439-31001461 GTGCCGGGGCTGAGGCTGGGCGG + Intronic
1139390506 16:66604500-66604522 GTGCCGGGGCGGTGATCGGGAGG + Intronic
1139517038 16:67458271-67458293 GAGGAGGGGATGTGACTGGGAGG + Intronic
1140473153 16:75226086-75226108 GTGCAGGGGCTGGGGGTGAGGGG - Intergenic
1140865864 16:79061641-79061663 GTTCAGGGGCAAAGAATGGGAGG + Intronic
1141912795 16:87071365-87071387 GAGGAAGGACTGTGAATGGGAGG - Intergenic
1142274329 16:89108546-89108568 TGCCAGGGGCTGGGAATGGGGGG - Intronic
1143321367 17:6070860-6070882 GTGCAGGGGTTGTGGGGGGGCGG + Intronic
1143444349 17:6998631-6998653 GGGCAGGGGCAGGGAAGGGGTGG - Intronic
1143711538 17:8739320-8739342 CTGGCGGGGCTGTGAGTGGGTGG + Intronic
1144242892 17:13331392-13331414 GTGCAGGGGTTGGGGGTGGGGGG - Intergenic
1145160114 17:20568417-20568439 AAGCAGGGCCTGTGGATGGGTGG - Intergenic
1145748882 17:27341232-27341254 TTGCAGGGGCTGGGAAGAGGTGG - Intergenic
1146619431 17:34386088-34386110 GGGCAGGGACTGAGGATGGGTGG + Intergenic
1146655451 17:34632236-34632258 GTGCAGGGGATGGGGATGGGGGG - Intronic
1146945495 17:36870354-36870376 GTGGAGGCGCTGTAACTGGGAGG + Intergenic
1148115548 17:45172696-45172718 GTGCAGGGGCTGTGCATGTGGGG + Intergenic
1148701013 17:49586969-49586991 TTTCAGAGGCTGTGAATGGTAGG - Intergenic
1150343895 17:64389297-64389319 GTCCCGGGGCTGTGAATAGAGGG - Intronic
1151428460 17:74046787-74046809 GGCCAGGGGCTGGGAGTGGGAGG - Intergenic
1151634078 17:75332059-75332081 GAGCAGGGCCTGTGAATGAGGGG + Intronic
1152272101 17:79330713-79330735 GTGGTGGGGCTGTGCCTGGGGGG + Intronic
1152661306 17:81543544-81543566 CTCCTGGGGCTGTGAGTGGGGGG + Intronic
1153330284 18:3866779-3866801 GGGCAGGGGCTGGGACTGGAAGG + Intronic
1154170233 18:12046209-12046231 GTCCGGGGGCTGGGAAGGGGAGG - Intergenic
1155484920 18:26331104-26331126 GTGCAGTGGGTGTCAATGTGGGG - Intronic
1157279217 18:46334604-46334626 GGGAAGGGGCTGTGATTTGGGGG - Intronic
1157780843 18:50437721-50437743 GGGCAGCGTCTGAGAATGGGTGG - Intergenic
1158150037 18:54357752-54357774 TTTCTGGGGCTGGGAATGGGGGG - Intronic
1158437202 18:57441965-57441987 GTCCAGGGGGTGGGAAGGGGTGG - Intronic
1159794219 18:72822243-72822265 GTGGAGGGGCTGGGAAAGGATGG + Intronic
1159798545 18:72869404-72869426 GCGCAGCGGCTGTGAGTGGGTGG + Intergenic
1160077657 18:75693497-75693519 GAGCAGGTGTTGTGAAGGGGAGG + Intergenic
1160535362 18:79588763-79588785 GTGCAGGGGCTGGGAGGGGGTGG - Intergenic
1160767802 19:816186-816208 GTGCATGGGTGGAGAATGGGTGG - Intronic
1160767856 19:816403-816425 GTGCATGGGTGGAGAATGGGTGG - Intronic
1160767945 19:816773-816795 GTGCATGGGTGGAGAATGGGTGG - Intronic
1160894093 19:1394762-1394784 CTGCAGGGCCTGGGAAAGGGCGG - Intronic
1161021695 19:2014241-2014263 GTGCAGGGCCTGGGGATGGAGGG + Intronic
1161641071 19:5423736-5423758 GTGGAGGGGTGGTGAGTGGGTGG - Intergenic
1161942652 19:7415348-7415370 GTGCAGGGGCCATGAAGTGGGGG - Intronic
1163114569 19:15181197-15181219 GGGCAGGGCCTGTGAGGGGGCGG - Intronic
1163829366 19:19540499-19540521 GGGGCGGGGCTTTGAATGGGCGG + Intronic
1164158572 19:22611488-22611510 GTGCAGAGGCTGGGAGGGGGAGG + Intergenic
1165236863 19:34428609-34428631 GTGCGGGGGCTGGGATTCGGGGG + Intronic
1165493978 19:36141242-36141264 GGGCGGGGCCTGGGAATGGGAGG + Intronic
1166913704 19:46179402-46179424 GTGCAGGGTCTGTGAGAGGCAGG + Intergenic
1167154055 19:47727431-47727453 GTGCTGGGGCTGGGGATGGAGGG + Intronic
1167291123 19:48625809-48625831 GGGCAGGGGCTGTGGACAGGAGG - Intronic
1167566584 19:50261158-50261180 GAGGAGGGGCAGTGATTGGGAGG - Intronic
1167619897 19:50554988-50555010 CTGCAGGGGCTGAGGAAGGGTGG - Intronic
1167774372 19:51545082-51545104 GTTCTGGGCCTGTGAATGGGAGG - Intergenic
1168025577 19:53641188-53641210 GTCCAGGGGCTGTGAATACGTGG + Intergenic
925370502 2:3341549-3341571 GTGGAGGGGGTGTGAGTGTGAGG + Intronic
925678820 2:6395386-6395408 TTACAGAGGATGTGAATGGGAGG + Intergenic
925834974 2:7935759-7935781 GTGCAGGAGCTGGCAATGAGAGG - Intergenic
926178449 2:10617914-10617936 TTGCAGGGGCTGGGAGAGGGAGG + Intronic
926754565 2:16224906-16224928 GTGCTGGGGTGGTGAATGGGAGG + Intergenic
931557251 2:63518983-63519005 ATGCACTGGCAGTGAATGGGAGG - Intronic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
934571127 2:95374055-95374077 CTGCAGGGGCTGCGATGGGGAGG + Intronic
935542677 2:104368080-104368102 GAGCAGCGGCTGTGCCTGGGAGG + Intergenic
936236099 2:110744001-110744023 GTGCAGGGTCAGTGCCTGGGGGG - Intronic
936844670 2:116816360-116816382 ATGCAGGTGCTGGGACTGGGAGG + Intergenic
937001325 2:118470409-118470431 GGGCGGGGGCAGAGAATGGGAGG - Intergenic
937840297 2:126518440-126518462 GAACAGGTGCTGTGAGTGGGTGG + Intergenic
941492277 2:166157337-166157359 GGGCATGGGCTGTGAAGAGGGGG - Intergenic
945060551 2:205905079-205905101 GAGGAGGGGCTGAGAAAGGGAGG - Intergenic
948133755 2:235620601-235620623 GAGGAGGGGCTGTGGCTGGGAGG - Intronic
948503479 2:238411449-238411471 GGGCTGGGGCTGTGGATGGAAGG + Intergenic
948601664 2:239111101-239111123 GTGACAGGGCTGTGAATGGCTGG - Intronic
948875017 2:240821416-240821438 GGGCTGGGGCTGGGAGTGGGGGG - Intergenic
1169343483 20:4813115-4813137 CTGCGGGGCCTGTGAATGGGAGG - Intronic
1169858290 20:10126627-10126649 AGGCAAGGGCTTTGAATGGGTGG - Intergenic
1170418660 20:16170880-16170902 GTGCTGTGGCTGTTAATTGGTGG - Intergenic
1170510428 20:17070906-17070928 GGGCAGGGGCTCAGAAAGGGTGG + Intergenic
1170584310 20:17722906-17722928 GGGATGGGGCTGTGAAAGGGAGG + Intronic
1170662979 20:18360703-18360725 GGGCACTGGATGTGAATGGGAGG + Intergenic
1172750288 20:37245952-37245974 AGGAAGGGGCTGTGAATGGGAGG - Intergenic
1172846938 20:37935226-37935248 TTGCAGGGGCTGGGGGTGGGGGG - Intronic
1172904152 20:38356386-38356408 GTGTGGGGGGTGTGAGTGGGTGG - Intronic
1173068445 20:39737222-39737244 GTGCAGGGGGTGGGGAAGGGAGG - Intergenic
1173911843 20:46676365-46676387 GTGAAGGGGCAGTGATTTGGAGG - Intronic
1174951826 20:55050785-55050807 GTGCAGGGGATGGGAAGGAGAGG + Intergenic
1175030769 20:55951522-55951544 TTGCAAGGGCTGTCAATTGGAGG - Intergenic
1175582552 20:60111709-60111731 GTGCAGTGTGTGTTAATGGGTGG - Intergenic
1175943200 20:62547331-62547353 GGGCAGTGGCAGTGGATGGGTGG - Intergenic
1175995247 20:62809385-62809407 GGGCAAGGGCTGTGCATCGGAGG + Intronic
1176307816 21:5133393-5133415 GTGCAGGGCCTGGGGGTGGGTGG - Intronic
1178093125 21:29185444-29185466 GTGCAGTGGGAGTGAAAGGGAGG + Intergenic
1179003993 21:37493671-37493693 GGTCAGAGGCAGTGAATGGGAGG + Intronic
1179849245 21:44128637-44128659 GTGCAGGGCCTGGGGGTGGGTGG + Intronic
1180005750 21:45019634-45019656 GGGCCGTGGCTGTCAATGGGAGG - Intergenic
1180081655 21:45490122-45490144 GAGCAGGGGCTGTGGAGGGATGG - Intronic
1180844212 22:18972648-18972670 ATGCCGGGGGTGGGAATGGGTGG + Intergenic
1181057258 22:20266063-20266085 ATGCCGGGGGTGGGAATGGGTGG - Intronic
1181823957 22:25498369-25498391 GAGCAGGGGCTGGGAATGCCAGG + Intergenic
1182279446 22:29209355-29209377 GGGCAGGGGCTGGGAAGAGGCGG - Intronic
1182485304 22:30635572-30635594 GGGGAGGGGCTGTGAGCGGGAGG + Intergenic
1182713987 22:32340628-32340650 GAGCAGGGGCTGTGGAAGGGAGG + Intergenic
1183102823 22:35594304-35594326 GTGCAGGTGCTGTGCAGGGGTGG - Intergenic
1183469541 22:37998173-37998195 GGGCAGGGGCAGGGAATGAGGGG + Intronic
1183476513 22:38038844-38038866 GTGCAGGCGCTGGGAGAGGGAGG - Intronic
1183700467 22:39448308-39448330 GGGCAGGGGCTGGGCCTGGGAGG - Intergenic
1184149665 22:42630837-42630859 GTGGAGGGGGTGTGGGTGGGTGG - Intronic
1184401306 22:44276214-44276236 GAACAGGGGCTGTGGAAGGGAGG + Intronic
1184657730 22:45950228-45950250 GTGCAGGGCCTGTGACTGAGAGG - Intronic
1184782246 22:46655255-46655277 GTGCTGAGGCTGGGAGTGGGTGG + Intronic
1185270659 22:49928136-49928158 GTGCACGGCCTGGGAAGGGGGGG - Intergenic
949538468 3:5013680-5013702 GAGCAGGAGCTGAGAGTGGGGGG - Intergenic
953210410 3:40870257-40870279 TTGGAGGGGGTGAGAATGGGTGG - Intergenic
954681478 3:52348454-52348476 GTGCAGTGGCAGTGACTGGTGGG - Intronic
954692315 3:52402154-52402176 GTCCAGGCCCTGGGAATGGGAGG - Exonic
954712526 3:52512235-52512257 GGGCAGGGGCTGGGGCTGGGTGG + Intronic
955784425 3:62521870-62521892 ATGGAGTGGCTGTGAAAGGGAGG - Intronic
956675916 3:71731571-71731593 GTGCAGGGCCTGTCCATGGCTGG + Intronic
961170162 3:124791898-124791920 CAGGAGGGGCTGTGAATGGATGG - Intronic
962599041 3:136976570-136976592 CTGCCGGGGCTGAGACTGGGAGG - Intronic
963734075 3:149000096-149000118 GTGGAGAGGCTGTGAATAGAGGG - Intronic
964474758 3:157088750-157088772 GGGCTGGGGCGGGGAATGGGAGG - Intergenic
968274068 3:197426431-197426453 GTGGAGGGACTGGGAATGGGAGG - Intergenic
968569328 4:1331316-1331338 GTGCAGGGCCTGGGAGTCGGGGG - Intronic
969198699 4:5584596-5584618 GTGCAGGCGCTGGGAAGGAGAGG - Intronic
971520686 4:27546763-27546785 GTGCAGGGGCTGTGGAGGCATGG - Intergenic
973659890 4:53093851-53093873 GTGAAGGGGCTAGGGATGGGTGG + Intronic
976492117 4:85683127-85683149 GTGCGGGGGCTGTAAAAAGGTGG + Intronic
978599486 4:110413004-110413026 GTACAGGGGCTCTGAAATGGAGG - Intronic
982230826 4:153206695-153206717 GGTCAGGGGGTGTGTATGGGTGG + Intronic
984711657 4:182890562-182890584 CAGCTGGGGCTGTGGATGGGAGG - Exonic
985522073 5:378614-378636 GTGCAGGTGCTAAGAGTGGGAGG + Intronic
985558248 5:568662-568684 GTGTCTGGGCTGTGAATGTGGGG - Intergenic
985564900 5:610712-610734 GTGCAGAGGATGTGTGTGGGAGG - Intergenic
988837218 5:35045309-35045331 GGGGAGGGGCTGTGATAGGGAGG - Intronic
989421386 5:41242981-41243003 TTGCAGAGGCTGGGGATGGGAGG + Intronic
990098633 5:52154561-52154583 ATGCAGGTGCTGTGTATGTGTGG + Intergenic
991114026 5:62933117-62933139 GTGAAGGGGCTGCCAATGTGAGG + Intergenic
991490559 5:67178984-67179006 GTGCAGTGGGTGAGAGTGGGTGG + Intergenic
991579669 5:68141155-68141177 GTGCAGGGGCAGAGTATGGTGGG - Intergenic
995691289 5:114829282-114829304 GTGAAGGTGCTGAGAATGGGTGG + Intergenic
999247314 5:150162025-150162047 GTCCAAGGGCTTTGGATGGGGGG - Intergenic
999304694 5:150511964-150511986 GTGCTGGGGGTGTGACTGGCTGG + Intronic
999440789 5:151599089-151599111 GAGCAGGGGCTGTCAAGGGATGG - Intergenic
999499483 5:152132405-152132427 GTGCAGGGGCTGTGGAGGCATGG - Intergenic
999765535 5:154737887-154737909 GTTCAGGGACTATGAAGGGGAGG - Intronic
1001569744 5:172722642-172722664 GGGCTGGGGGTGTGGATGGGGGG - Intergenic
1001894372 5:175365797-175365819 GTTGAGGGGCTATGAAGGGGTGG - Intergenic
1002345956 5:178547651-178547673 GTGTGGGGGGTGTGTATGGGGGG - Intronic
1002376432 5:178792264-178792286 GTGCAGAACCTGTGACTGGGGGG - Intergenic
1002619609 5:180478388-180478410 CTACTGGGGCTGTGAAAGGGAGG + Intergenic
1002675529 5:180909194-180909216 AGGCAGGGGCTGAGAAGGGGTGG - Intronic
1002678129 5:180935717-180935739 GGGAGGGGGCTGGGAATGGGGGG - Intronic
1006151961 6:31994519-31994541 GTGGAGGGGCTGTGCCTGGCTGG + Exonic
1006158263 6:32027257-32027279 GTGGAGGGGCTGTGCCTGGCTGG + Exonic
1006421303 6:33935768-33935790 GTGCAGTGGCTGAGGGTGGGTGG - Intergenic
1007627360 6:43254001-43254023 GTGAAGGGGCTGGGAAAGGATGG + Intronic
1007705364 6:43787528-43787550 GGGCAGGGGCAGGGAGTGGGTGG + Intergenic
1008414264 6:51221294-51221316 GGGCAGGGGCGGGGGATGGGGGG + Intergenic
1010001640 6:70955630-70955652 GTGGAGGGGCTGTGTGTGAGAGG - Intronic
1012982987 6:105849707-105849729 GAAGAGGAGCTGTGAATGGGAGG - Intergenic
1014150101 6:118044518-118044540 GCTCAGAGGCTGTGACTGGGAGG + Intronic
1014216263 6:118755348-118755370 TTGAAGGGGCTGTGAAGGGAAGG - Intergenic
1014320198 6:119918478-119918500 GTGTAAGGGCTGGGAATGAGAGG - Intergenic
1014812213 6:125900062-125900084 CTGCAGGGGCTGTGGAATGGGGG + Intronic
1016031530 6:139343509-139343531 GTACAGGAGCTGGGACTGGGAGG + Intergenic
1019036279 6:169062535-169062557 GTGCAGGGGCTGCTGGTGGGAGG + Intergenic
1019144029 6:169965384-169965406 GTGCAGATGCTGAGCATGGGCGG + Intergenic
1019177116 6:170165570-170165592 GTGCATGGGGTGTGATTGTGAGG - Intergenic
1019407713 7:892441-892463 GGGAGGGGGCTGTGAATGTGCGG + Intronic
1019729040 7:2620250-2620272 AGGCAGGGGCTGAGATTGGGAGG - Intergenic
1019747762 7:2710024-2710046 GTGTGGTGGCTGTGACTGGGAGG + Intronic
1021911109 7:25386595-25386617 GGGCAGGGGGAGTGAATAGGGGG + Intergenic
1022535408 7:31095526-31095548 GTGAGAGGGCAGTGAATGGGGGG + Intronic
1023082610 7:36539330-36539352 GTGCAGGTGCTGTCAATATGGGG + Intronic
1024227946 7:47342427-47342449 GCACAGTGGCTGTGAATGGCAGG + Intronic
1025620545 7:63166279-63166301 GTACAGGGGCTCTGAAATGGAGG - Intergenic
1025942863 7:66086677-66086699 GTGCAGGGGCTGTGCTAGAGGGG + Intronic
1026788459 7:73316825-73316847 CTGAAGGGGCTGTGCAGGGGAGG - Intronic
1026974790 7:74490639-74490661 GTGCGGGGGCCGTGTTTGGGTGG + Intronic
1027916795 7:84334780-84334802 GGGCAGGGGTTGTGAGTGAGAGG - Intronic
1027926782 7:84475110-84475132 GTGCAGGGGCTGGGAAAGAGGGG + Intronic
1027957505 7:84899757-84899779 ATACAGAGGCTGTGAATGGGGGG + Intergenic
1029663304 7:101978278-101978300 GTGCAGGCGGTGTGTGTGGGAGG - Intronic
1030653133 7:112137295-112137317 GTGCAGGTGCTGAGACTGGCTGG - Intronic
1031972441 7:128074433-128074455 GTGCAGGGGCTGTGCCCGTGGGG - Intronic
1032078309 7:128846497-128846519 GGCCAGGGGCTGGGAAAGGGTGG - Intronic
1032191051 7:129766139-129766161 GTGCATGGGCTCTGAGTGGAGGG - Intergenic
1032474546 7:132203171-132203193 GTGGAGAGGCTGTGAAGGAGGGG + Intronic
1032781557 7:135168620-135168642 GTGGAGGGGCTGTGGGCGGGAGG - Intronic
1034276632 7:149826703-149826725 GTGCAGGGGCAGGCAGTGGGAGG - Intergenic
1034478696 7:151303585-151303607 GCGCAGGGGCTGCGGCTGGGCGG + Intergenic
1034541968 7:151764098-151764120 GTGGACGGGGTGTGAATTGGGGG + Intronic
1034758975 7:153653072-153653094 GTGGGGGGGCTGTGCATGTGTGG + Intergenic
1035231751 7:157469702-157469724 GTGTAGGGTCTGCGGATGGGAGG + Intergenic
1036717426 8:11139363-11139385 GTGCAGGGGCAGTGACTGCTGGG - Intronic
1036792666 8:11732344-11732366 GTGCAGGTGCTTTAGATGGGAGG + Intronic
1037882494 8:22579828-22579850 GCGGAGGGGCTGTGGATGGGAGG + Intronic
1038224794 8:25645783-25645805 GGGCAGGGGCGGTGGAGGGGAGG + Intergenic
1038234400 8:25737869-25737891 ATGCAGGAGTTGTGGATGGGTGG - Intergenic
1038425523 8:27461810-27461832 GTGCAGGGGCTGTGAATGGGGGG - Intronic
1039310390 8:36312268-36312290 GAGCAGGAGGTGTGCATGGGTGG - Intergenic
1041260796 8:56019154-56019176 GAGGAGGGGGTGGGAATGGGCGG + Intergenic
1047202974 8:122781922-122781944 GCGCTGGGGCTGTGAACGCGGGG - Exonic
1047472712 8:125194256-125194278 TGCCAGGGGCTGGGAATGGGGGG - Intronic
1048499278 8:134960960-134960982 GTGCAGGAGTGGTGAATAGGAGG + Intergenic
1048832144 8:138487648-138487670 GGGCAGGGGCTGGGCAGGGGTGG + Intronic
1049189300 8:141278170-141278192 GTGCTGGGGCTGTCAGAGGGCGG - Intronic
1049196887 8:141320646-141320668 GTGCAGGTGCAGGGACTGGGTGG + Intergenic
1049286952 8:141780987-141781009 GTGCAGAGGCTGGGCCTGGGTGG + Intergenic
1049384125 8:142332388-142332410 GGGCAGGGGCAGTGAGAGGGAGG + Intronic
1049767062 8:144359742-144359764 GTGCAGGTGCTGGGCATGGTGGG + Exonic
1049770428 8:144377969-144377991 GTGCAGGGGCAGGGATGGGGTGG + Intronic
1051366441 9:16324616-16324638 GTCCAAAGGCTGGGAATGGGTGG + Intergenic
1051590550 9:18772938-18772960 GAGGAGGGGCTGGGAATGGTGGG + Intronic
1053150764 9:35741299-35741321 CTGCATGGCCTGTGAAAGGGAGG - Intronic
1055934432 9:81591599-81591621 ATGAAGGGGCTGTGGGTGGGGGG + Intronic
1056651183 9:88464914-88464936 TGCCAGGGGCTGGGAATGGGAGG - Intronic
1056771733 9:89482441-89482463 CTGCTGGGGCTGAGAATGGCTGG - Intronic
1056905391 9:90642959-90642981 GTGCAGGGGCTGCGAGCGGGTGG - Exonic
1058755251 9:108077565-108077587 GTGAAGGGGCTGTTCTTGGGAGG - Intergenic
1059561500 9:115339078-115339100 GTGCAGAGGGTGTTCATGGGTGG - Intronic
1059791542 9:117646072-117646094 GTCCAGGAGCTGGAAATGGGTGG + Intergenic
1060673932 9:125495274-125495296 CTGCAGTGACTCTGAATGGGAGG - Intronic
1060827688 9:126696028-126696050 GGGCAGGGGCTGTGCTGGGGCGG - Intronic
1060958245 9:127660016-127660038 GTGGACGGACTGTGGATGGGGGG - Exonic
1061003637 9:127916461-127916483 GGGCTGGGGCTGGGAAGGGGTGG + Exonic
1061729360 9:132601557-132601579 GTGCAGGGGATGATAATGGCAGG - Intronic
1061846982 9:133393444-133393466 GTGCATGGGTTGTGGATGGATGG + Intronic
1062032737 9:134369307-134369329 GTGCAGGGGTTGTGTGTGTGGGG + Intronic
1062327434 9:136018968-136018990 GGGCAGGGGCTGGGGAGGGGCGG - Intronic
1186493388 X:9992792-9992814 GCCCAGGGGCTGGGAGTGGGCGG + Intergenic
1187277075 X:17825586-17825608 TTCCAGGGGCTGTGCATGTGTGG + Intronic
1190248669 X:48706808-48706830 GTTCAGGGGCTGGGAATGAGGGG - Intronic
1190877462 X:54470182-54470204 GGGCAGAGGCTGTGGCTGGGGGG + Exonic
1194433937 X:93847239-93847261 GTGAAGGGTGTGTGAATAGGAGG - Intergenic
1195689224 X:107610226-107610248 GGGCAGGGGCAGGGAAGGGGAGG - Intergenic
1199758290 X:150885159-150885181 GGGAGGGGGCTGTGACTGGGAGG + Intronic
1200223310 X:154402833-154402855 GTTGAGGGCCTGGGAATGGGTGG + Exonic
1200292026 X:154884480-154884502 GGGCAGGGGGTGTGTGTGGGAGG + Intronic
1200338864 X:155380217-155380239 GGGCAGGGGGTGTGTGTGGGAGG + Intergenic
1200347605 X:155460475-155460497 GGGCAGGGGGTGTGTGTGGGAGG - Intergenic