ID: 1038426117

View in Genome Browser
Species Human (GRCh38)
Location 8:27465016-27465038
Sequence CAGTCAAGGCCTTTTGCAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038426117_1038426121 -9 Left 1038426117 8:27465016-27465038 CCGTTTGCAAAAGGCCTTGACTG 0: 1
1: 0
2: 2
3: 11
4: 166
Right 1038426121 8:27465030-27465052 CCTTGACTGATGGTAGGATTTGG No data
1038426117_1038426124 24 Left 1038426117 8:27465016-27465038 CCGTTTGCAAAAGGCCTTGACTG 0: 1
1: 0
2: 2
3: 11
4: 166
Right 1038426124 8:27465063-27465085 GGCAGAGAGCCTTCCAGTAGAGG No data
1038426117_1038426123 3 Left 1038426117 8:27465016-27465038 CCGTTTGCAAAAGGCCTTGACTG 0: 1
1: 0
2: 2
3: 11
4: 166
Right 1038426123 8:27465042-27465064 GTAGGATTTGGCTGAGAAATGGG No data
1038426117_1038426122 2 Left 1038426117 8:27465016-27465038 CCGTTTGCAAAAGGCCTTGACTG 0: 1
1: 0
2: 2
3: 11
4: 166
Right 1038426122 8:27465041-27465063 GGTAGGATTTGGCTGAGAAATGG No data
1038426117_1038426125 25 Left 1038426117 8:27465016-27465038 CCGTTTGCAAAAGGCCTTGACTG 0: 1
1: 0
2: 2
3: 11
4: 166
Right 1038426125 8:27465064-27465086 GCAGAGAGCCTTCCAGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038426117 Original CRISPR CAGTCAAGGCCTTTTGCAAA CGG (reversed) Intronic
900348134 1:2221066-2221088 CAGGCCAGGCCTTTTGGAGACGG + Intergenic
900589597 1:3453815-3453837 CAGGAAAGGCCTGTTGCCAAAGG - Intergenic
905805070 1:40870504-40870526 GAATTAAGGCCTTTTGCTAATGG + Intergenic
906037325 1:42759529-42759551 AAATGAAGGCCTTTTGTAAATGG + Intronic
907025356 1:51112618-51112640 CAATAAAGGACTTTTTCAAATGG + Intronic
912650105 1:111430429-111430451 CAGTAAAGGACATTTGCAAATGG - Intergenic
915749623 1:158193849-158193871 CATTCAAGGGCTTTTCAAAATGG + Intergenic
917269738 1:173259252-173259274 CAGTCAAGCCCTTCTTCAATAGG - Intergenic
918984513 1:191606957-191606979 CCTTCAAGGCCTTTTGTTAAAGG - Intergenic
919418897 1:197346371-197346393 CAGCCAAGCCCTTTGGCAACAGG + Intronic
920950612 1:210568725-210568747 CAGTGTAGGCCCTGTGCAAATGG + Intronic
921029660 1:211326526-211326548 CAAGCAAGGCCTTGAGCAAATGG + Intergenic
921108576 1:212009826-212009848 CAGGAAAGCCCTTTTGCTAATGG + Intronic
1063666254 10:8062443-8062465 AAGTTAAAGACTTTTGCAAATGG - Intronic
1069096168 10:64262478-64262500 CACTCATGGCTTTTTGCAGAGGG - Intergenic
1071130698 10:82390203-82390225 CAGAGATGGCCTTTTGAAAATGG - Intronic
1072075204 10:91964332-91964354 AAGACAAGGCCTTCTGAAAACGG - Intronic
1073267792 10:102238654-102238676 CTGTGAAGGCCCTCTGCAAATGG - Intronic
1076091869 10:127693479-127693501 CAGGCAGGGCCTTTTGTATATGG + Intergenic
1079369732 11:19840539-19840561 CAGTCAAGGTGTCTTCCAAATGG - Intronic
1080343892 11:31299507-31299529 AAATCAAGGCCTTTTATAAAAGG - Intronic
1083597905 11:63928114-63928136 CAGGTAAGGCATTTTGCACATGG - Intergenic
1084146757 11:67269131-67269153 AAGGCAAGGCGTTATGCAAAGGG - Intronic
1085155185 11:74286900-74286922 AAGCCAAAGCCTATTGCAAAAGG + Intronic
1086862984 11:91947213-91947235 AAGTCAAAGCCTTTTGCAGAAGG + Intergenic
1088073143 11:105814134-105814156 GAATCAAGGCCTTTAGCACATGG + Intronic
1091291661 11:134443745-134443767 CAGACAAGGCCTCTTCCAAGAGG - Intergenic
1092559529 12:9596403-9596425 CACTGAGGGCCTTTTGGAAAAGG - Intronic
1092995271 12:13943727-13943749 CAGGAAAGGCCTTTTGGATAAGG - Intronic
1095618582 12:44222409-44222431 CAGTCTAGGGCATTTGTAAATGG - Intronic
1096227654 12:49876932-49876954 CAGTCAGGTCATTTTGCACAAGG + Intronic
1102538937 12:113604220-113604242 CACTCAAGGCCTTTAGCAAAGGG - Intergenic
1103743757 12:123108484-123108506 CAGCCAAGACCTTTGGCAACAGG + Intronic
1106345547 13:28873406-28873428 AAGTCAAGTCCTCTTGTAAAGGG + Intronic
1106934578 13:34704106-34704128 AAGTCAATCCCTTTTGCAATGGG + Intergenic
1107196493 13:37658895-37658917 CAGAAAAGGCCTCCTGCAAAAGG + Intronic
1107845646 13:44510036-44510058 TAGTCAAGGCCCTTTGGAAAAGG + Intronic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1110073279 13:71206488-71206510 CAGTTAAGCCCTTTTGCAAAAGG - Intergenic
1113113912 13:106854558-106854580 CAGTCATGGCCTTTTGAGACTGG + Intergenic
1116498792 14:45595094-45595116 GAGTCAAGTCTTGTTGCAAAGGG - Intergenic
1118872470 14:69754743-69754765 CAGTCAGGGCCATTTTGAAATGG + Intronic
1121318214 14:92974743-92974765 CACTCAAGGCCAATGGCAAAAGG + Intronic
1126782910 15:52153848-52153870 CAGAAAAGGGCTTTTGGAAAGGG + Intronic
1127762335 15:62151545-62151567 GAGTCAAGGTCATTGGCAAAGGG - Intergenic
1129093704 15:73181101-73181123 AATTCAAGGCCTATTACAAAGGG - Intronic
1130751336 15:86716198-86716220 CAGTCTAGGTCTTTCTCAAAAGG + Intronic
1131200922 15:90395173-90395195 GATTCAAGGCTTTTTGCTAAGGG + Intronic
1134514334 16:14874484-14874506 CAGTCAAGGCCTTTCTGATAAGG - Intronic
1134702009 16:16273132-16273154 CAGTCAAGGCCTTTCTGATAAGG - Intronic
1134969822 16:18521518-18521540 CAGTCAAGGCCTTTCTGATAAGG + Intronic
1135139726 16:19911264-19911286 CAATCAAGGCATTTAGCTAATGG + Intergenic
1137413036 16:48245197-48245219 CAGTAAAGGCCCTTTACAAAGGG - Intronic
1143679066 17:8462662-8462684 CAGTGGAGGGCTTTTTCAAATGG - Intronic
1145758309 17:27408943-27408965 AAGGCAAGGCCTCTTGCAGAGGG - Intergenic
1146110917 17:30088691-30088713 CAGTCATTCCCTTTTGCAATAGG - Intronic
1147669706 17:42169903-42169925 CAGGCGTGGACTTTTGCAAAGGG - Intronic
1147696208 17:42355786-42355808 CAGTCAAGACCACTTACAAAAGG + Intronic
1149691412 17:58580114-58580136 CAGTCACTGCCTCTTCCAAAAGG - Intronic
1150980957 17:70141014-70141036 CAGTTAAGTACTTTTGGAAATGG - Intergenic
1153929031 18:9862124-9862146 CAGTCAAGGACTTTGGCATGTGG + Exonic
1155646218 18:28081080-28081102 CAGGCAAGGTCCTTTGCATATGG - Intronic
1156732991 18:40217966-40217988 CAGTCAAAGTCTTTTTGAAATGG + Intergenic
1157397403 18:47354339-47354361 CAGGCAGCGACTTTTGCAAATGG + Intergenic
1158903105 18:61984708-61984730 AAATTAAGCCCTTTTGCAAAGGG - Intergenic
1159615433 18:70574157-70574179 CAGTCAAAGCATTTAGCAATTGG - Intergenic
1159974347 18:74692195-74692217 CAGTCAAGGCCATTAGCATGGGG + Intronic
1164650717 19:29889720-29889742 TTTTCAAGGCCTTTTGGAAAGGG + Intergenic
1168470865 19:56639497-56639519 CAGGGAAGGCCTTTTAGAAAAGG - Intergenic
1168585740 19:57590299-57590321 CATTGAAGCCCTTTCGCAAATGG + Exonic
1168634262 19:57983060-57983082 CAGTAAAAGCTTTTTACAAATGG + Intronic
1168659343 19:58154320-58154342 CACTCAAGGCCTTTTGCTGCTGG + Intronic
1168710536 19:58497634-58497656 CAGTAAACGCCATATGCAAAGGG - Intronic
925346488 2:3175506-3175528 CACACAAGGGCTTTTGGAAATGG + Intergenic
926658206 2:15433640-15433662 GAGACAATGCCTTTTGGAAATGG - Intronic
926840658 2:17076644-17076666 CTGTCAATGCCTTTTACACATGG + Intergenic
929050503 2:37832693-37832715 CAGTCAATGCCTTTACAAAAAGG - Intergenic
929071807 2:38038685-38038707 CAGTAAAAGCCTTTTGGAATCGG + Intronic
932180334 2:69641342-69641364 CAGTTAAGGGCTTTGGCACAGGG + Intronic
932307262 2:70712971-70712993 CAGACAAGGCCCTTTGCATGAGG - Intronic
937529478 2:122810619-122810641 CATTAAAGGCCTTGTCCAAAAGG + Intergenic
938748148 2:134300771-134300793 CAGTGAAGGTCGTTGGCAAAGGG + Intronic
938782511 2:134598187-134598209 CAGTCAGGGCATTTTACACAGGG - Intronic
938789391 2:134663441-134663463 CAGTCAGGGTCTTCTGCAAAGGG - Intronic
946162339 2:217843027-217843049 CAGTCTAGGCTTTGTGAAAATGG - Intronic
947844949 2:233236443-233236465 CAGTCAAGGCTTTCTGCTTATGG + Intronic
948980455 2:241491849-241491871 CAGTCAAGCCCTCTTTGAAAAGG + Intronic
1168918763 20:1513648-1513670 CAGAAAAGGCTTTTTGTAAAAGG - Intergenic
1169271512 20:4203017-4203039 AAGTCAAGTCCTTTTGAAAGTGG - Intergenic
1170541832 20:17396881-17396903 CAGTGAAGGCCTCTAGGAAATGG + Intronic
1171263973 20:23755389-23755411 CAGTCACTGCATTTTGCTAAAGG - Intergenic
1172786380 20:37471578-37471600 CAGGGAAGGCCTCTTGGAAAAGG - Intergenic
1173580606 20:44144073-44144095 CTGTGAAGACCTGTTGCAAAGGG + Intronic
1176306294 21:5125120-5125142 CAGTCAAGGCCCATGGGAAATGG + Intronic
1177782706 21:25638120-25638142 CAGCCAAGGCATTTGACAAATGG - Intergenic
1177905093 21:26965360-26965382 CACTCAAGAACTTTTGCAAGTGG - Exonic
1178568241 21:33709022-33709044 TAGTCAAGGCCTTTTGGGATTGG - Intronic
1179850764 21:44136910-44136932 CAGTCAAGGCCCATGGGAAATGG - Intronic
1180639111 22:17283776-17283798 CACCCCAGGCCTTGTGCAAAAGG - Intergenic
1183126339 22:35784946-35784968 CACTCCAGGCCTCTTGCAAAGGG + Intronic
949699624 3:6741848-6741870 TAGTCAAGGACTTTTAAAAATGG + Intergenic
950608982 3:14112822-14112844 ATGACAAGGCCTTTTGCAAAAGG + Exonic
951680452 3:25289420-25289442 CAGACCTGGCCTTTTGGAAAAGG - Intronic
952144075 3:30512774-30512796 CAGTAAAGGCTTTTGGTAAAGGG + Intergenic
952660647 3:35842493-35842515 CATTCAAGGCCATTAGCAATCGG - Intergenic
953911187 3:46893798-46893820 GAGTCAGGGCCTTTTGAAAGGGG + Intronic
954950641 3:54469321-54469343 CAGTCAGGTCCCTCTGCAAAAGG - Intronic
956636750 3:71372356-71372378 CAGGGAAGGCCTCTTGGAAAAGG - Intronic
961316595 3:126040442-126040464 GAGGAAAGGCCTATTGCAAAAGG + Intronic
963177256 3:142312861-142312883 AAGTGTAGGCCTTTTGCCAAAGG - Intronic
963542808 3:146615885-146615907 AATTGAAAGCCTTTTGCAAAAGG + Intergenic
965691892 3:171366118-171366140 CAGCCAAGACCTTTAGTAAATGG + Intronic
966593732 3:181708435-181708457 CAGTTAAGGCCTTTTGGCTAGGG + Intergenic
967103534 3:186236725-186236747 TAGTCAAGGGCTTTTGAGAAAGG + Intronic
970025338 4:11617910-11617932 TATTTAAGGCCTTTTGCAGATGG - Intergenic
973642715 4:52919044-52919066 CAGCCATGGCCTTTGGAAAATGG - Intronic
973784737 4:54324232-54324254 CAGACAAGGGCTTTTCCCAAAGG + Intergenic
976517806 4:85990958-85990980 AAGTCAAGCCTTTTTGGAAATGG + Intronic
980446077 4:132909496-132909518 AAGTAAATGCATTTTGCAAATGG - Intergenic
983657776 4:170100189-170100211 CAACCAAGGCTTTTTGCACAGGG - Intergenic
984367588 4:178818864-178818886 CAATCATGGGCTTTTGCCAAAGG + Intergenic
984452514 4:179921109-179921131 CAGTCAGTGCCTTTTACAAATGG + Intergenic
985586278 5:738180-738202 AAGTCAACCCCTTTTGCAACAGG + Intronic
985600867 5:830366-830388 AAGTCAACCCCTTTTGCAACAGG + Intronic
986443126 5:7798500-7798522 CAGTGTGGGCCTTTTGCAAGTGG - Intronic
986574755 5:9200052-9200074 CAGACAAGGTTTTTTTCAAACGG - Intronic
987638058 5:20571865-20571887 CAGTCTAAGCTTTTTTCAAATGG - Intronic
988924021 5:35971007-35971029 CATTCAAGGCCTATTTCAATAGG + Intronic
992361181 5:76039852-76039874 CAGTCAATGCCCTTTCCATATGG + Intergenic
992393083 5:76347282-76347304 CAGACCATGCCTTTGGCAAAGGG - Intronic
994451743 5:99951860-99951882 CAGTTCAGGACTTTTTCAAAGGG - Intergenic
995994097 5:118278870-118278892 GAGTCAAGGCTATTTGCCAAGGG - Intergenic
998506543 5:142677012-142677034 CAGTCCAGGCTTTTTGCAGTTGG - Intronic
999706516 5:154277493-154277515 CATCCCAGGCCCTTTGCAAAGGG - Intronic
1005894360 6:30164862-30164884 CATTCAAGGCCCTTTGCAGTCGG + Intronic
1008435121 6:51466845-51466867 AAGGCAATGCCTTTTGTAAAAGG - Intergenic
1009633486 6:66232181-66232203 CAGTGAAGGACTTTGGCAGATGG + Intergenic
1011790536 6:90893855-90893877 CAGTAAAGGCCGATTTCAAATGG + Intergenic
1012238665 6:96847626-96847648 CAGTCATATCCATTTGCAAATGG - Intergenic
1014962835 6:127707892-127707914 CAGTCAAGCAGTTTTGGAAAAGG - Intergenic
1017959073 6:159206272-159206294 CAATCAAAGCCTTTGGCCAATGG + Intronic
1018444197 6:163840326-163840348 CAATCATGGTCTTTTGCACAAGG + Intergenic
1019062702 6:169267701-169267723 CCATGATGGCCTTTTGCAAAAGG - Intergenic
1019660452 7:2221039-2221061 CAGTCAAGGCCTAGTGCGCAGGG + Intronic
1020745234 7:12071554-12071576 AAGTCAAGACCTTTTTCATAAGG + Intergenic
1021568019 7:22033489-22033511 GAGTCAAGACTTTTTGAAAATGG + Intergenic
1022071503 7:26920166-26920188 CAATAAATGCCTTTTTCAAAGGG - Intronic
1022181849 7:27928417-27928439 CAGGCAAGGCCTTTTACGACTGG + Intronic
1022265178 7:28746660-28746682 CTATCAAGTCCTTTTGCAGATGG + Intronic
1022640188 7:32174643-32174665 TATTCAAGGCACTTTGCAAATGG - Intronic
1030150511 7:106399690-106399712 TTATGAAGGCCTTTTGCAAAAGG - Intergenic
1031687919 7:124755006-124755028 AAATTAAGACCTTTTGCAAAAGG - Intronic
1033959612 7:146897964-146897986 CAGTGAATGCCGTTTACAAATGG + Intronic
1035196000 7:157220998-157221020 CTTTGGAGGCCTTTTGCAAAAGG - Intronic
1035433618 7:158841045-158841067 CATTCAAGGCCCTTTACAAATGG + Intergenic
1036032030 8:4984631-4984653 TAGTCATAGCCTTTTGTAAAGGG + Intronic
1038426117 8:27465016-27465038 CAGTCAAGGCCTTTTGCAAACGG - Intronic
1042738633 8:72017667-72017689 CAGTTAAGGTCTTTCACAAAAGG - Intronic
1043841030 8:85104831-85104853 CAATCATGACCTTATGCAAATGG - Intergenic
1044793255 8:95869970-95869992 CAGAGAAGGCCTTATGGAAAAGG + Intergenic
1045773825 8:105777644-105777666 AAATCAAAGCATTTTGCAAAAGG - Intronic
1047895274 8:129359743-129359765 CAGTGAAGGCCTTGTGGAGAAGG + Intergenic
1050530060 9:6580876-6580898 TAGGCATGGCCTTTGGCAAATGG - Intronic
1051327854 9:15992351-15992373 CAGAAAAGGCCTTTGACAAAAGG + Intronic
1053425954 9:38010280-38010302 CAGTCATTAGCTTTTGCAAAGGG - Intronic
1059395340 9:114030982-114031004 CACACAAGGCCTTTTTCAAAAGG + Intronic
1059773966 9:117456067-117456089 CAGCCAAGTGGTTTTGCAAAGGG - Intergenic
1059945588 9:119405456-119405478 CAGTCAAGGCACTTTTCAGAGGG - Intergenic
1061318509 9:129813175-129813197 CAGTCACTCCGTTTTGCAAAAGG - Exonic
1203779361 EBV:92311-92333 AGTTCAAGGCCTTTTGCAAGTGG - Intergenic
1187825050 X:23326661-23326683 TAGTCAAGGCATTTTAGAAATGG + Intergenic
1193349328 X:80441319-80441341 TAGTCCATGCATTTTGCAAAAGG - Intronic
1194269078 X:91787581-91787603 ATTTCAAGGCCCTTTGCAAAGGG + Intronic
1196064093 X:111443695-111443717 CCTTCGTGGCCTTTTGCAAAAGG + Intergenic
1196263113 X:113608975-113608997 CTGTCAAGCCCTTTTACAAGGGG + Intergenic
1196342222 X:114608090-114608112 CAGTCAGTCCCTCTTGCAAAGGG + Intronic
1198555383 X:137787629-137787651 CAGGCAATGCCTTTTTCAAGAGG - Intergenic
1200586294 Y:5008589-5008611 ACTTCAAGGCCCTTTGCAAAGGG + Intronic
1200766344 Y:7083784-7083806 CAGACAAGGCCTATTGAAGAGGG - Intronic
1202046159 Y:20738846-20738868 CAGACAAGGCCTATTGAAAAGGG - Intergenic