ID: 1038426655

View in Genome Browser
Species Human (GRCh38)
Location 8:27468324-27468346
Sequence GCTGAGGGCCAGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 874
Summary {0: 1, 1: 0, 2: 9, 3: 86, 4: 778}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038426655_1038426661 25 Left 1038426655 8:27468324-27468346 CCTGCTTCCCTCTGGCCCTCAGC 0: 1
1: 0
2: 9
3: 86
4: 778
Right 1038426661 8:27468372-27468394 GTGACCCCCTGATAGCTCCTGGG No data
1038426655_1038426660 24 Left 1038426655 8:27468324-27468346 CCTGCTTCCCTCTGGCCCTCAGC 0: 1
1: 0
2: 9
3: 86
4: 778
Right 1038426660 8:27468371-27468393 AGTGACCCCCTGATAGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038426655 Original CRISPR GCTGAGGGCCAGAGGGAAGC AGG (reversed) Intronic
900101217 1:962931-962953 GCACAGGGCAAGAGGGAAACGGG - Intronic
900308500 1:2022417-2022439 CCTGGGGGCGAGAAGGAAGCAGG - Intronic
900472795 1:2863049-2863071 ACTGAGGGCCACGGAGAAGCTGG - Intergenic
900472948 1:2863554-2863576 GCTAAGGGACTGAAGGAAGCAGG - Intergenic
900554510 1:3273018-3273040 GCTGTGGTCGAGAGGGCAGCCGG + Intronic
900673688 1:3870958-3870980 GCTGCGGACCACAGGGAAGACGG + Intronic
900745355 1:4356920-4356942 GCTGAGTGCCCGAGGGGAGGAGG - Intergenic
900869696 1:5293198-5293220 ACAGAGGCCCAGAGGGAAGGAGG + Intergenic
900902941 1:5529020-5529042 GCGGAAGGCTAAAGGGAAGCAGG - Intergenic
900951083 1:5858608-5858630 GCTGAGGGTCTGAGGGGAGCAGG - Intergenic
901019323 1:6247987-6248009 CCTGAGGGCCAGAAGGAACTGGG + Exonic
901201303 1:7468930-7468952 GCTGATGGCCACAGGAGAGCTGG + Intronic
901314232 1:8294922-8294944 GCAGCGGGACAGAGGGAACCTGG + Intergenic
901626739 1:10629198-10629220 GCTGAGGATCAGAAGGAAGCAGG + Intronic
901823550 1:11846118-11846140 GGTGGGGGCCGGTGGGAAGCAGG - Intronic
902510940 1:16966582-16966604 GCTGAGGGCCAGCGGGGCGACGG + Intronic
902511700 1:16970208-16970230 GCTCAGGCCCAGAGGGATTCGGG + Intronic
902518995 1:17005237-17005259 GCTGAGGTCCAGAGAAGAGCGGG + Intronic
902667815 1:17951876-17951898 GAGGAGGGACAGTGGGAAGCAGG + Intergenic
902840315 1:19070171-19070193 ACTCAGGGCCCGCGGGAAGCTGG - Intergenic
903648443 1:24908881-24908903 CCTGAGGCCCAGAGAGAAGAAGG - Intronic
903708364 1:25303494-25303516 GCTGAAGGCCAGCAGGACGCTGG + Intronic
903718752 1:25388919-25388941 GCTGAAGGCCAGCAGGACGCTGG - Intronic
903832388 1:26182987-26183009 GCTAAGAGCCAGAGGGAAGCTGG - Intronic
903936329 1:26897591-26897613 GCTGATGCCCAGAGGGAATGTGG - Exonic
904262491 1:29297714-29297736 GCTGAGAGACAGAGAGAGGCAGG + Intronic
904580603 1:31541093-31541115 GCTGAAGGCAAAGGGGAAGCCGG + Intergenic
904629429 1:31829984-31830006 GCTGTGGGAAGGAGGGAAGCAGG + Intergenic
904961141 1:34333946-34333968 GCTGAGGTCCAGAAGGCAGTGGG - Intergenic
905852693 1:41285936-41285958 GCTGAGGGCCAGTGGGGTGGGGG + Intergenic
906155537 1:43611974-43611996 GGTGAGGGCCAGAAGGAGACCGG + Intronic
906476065 1:46170334-46170356 GATGAGGGGCAGGGGGCAGCAGG - Intronic
906531076 1:46524417-46524439 GCTGAGGACCTCAGGGAACCAGG + Intergenic
907203720 1:52750773-52750795 GCTTAGGGTTAGAGGGAAGGTGG - Intronic
907215034 1:52855568-52855590 GCTTAGGGCTGGAGGGATGCGGG - Intronic
907301679 1:53490797-53490819 GGGGAGGGCAAGAGGGAGGCTGG - Intergenic
907454818 1:54568649-54568671 GCTGGGGGCCAGAGGCATGGTGG - Intronic
907566839 1:55443372-55443394 ACTAAGGGCCAGAGAGCAGCAGG - Intergenic
907667901 1:56449358-56449380 GCTGAGGGACATATGGAACCTGG - Intergenic
908008169 1:59748230-59748252 GGTGAGGACCACAGAGAAGCAGG + Intronic
908142759 1:61204158-61204180 CAAGAGGGCCAGAGGAAAGCAGG - Intronic
908262294 1:62348565-62348587 GCGGAAGGCCAAGGGGAAGCAGG + Intergenic
908527651 1:65002944-65002966 GCTTGGGGCCAGCGGGAACCGGG + Intergenic
908879620 1:68716076-68716098 ACTGAGGGGCTGAGGGAAGCTGG - Intergenic
910449595 1:87331845-87331867 GCTGAGGGGGAGAGGGAAGAAGG - Intronic
912189294 1:107318887-107318909 CCTGAGGGCCAGTGGGCAACTGG + Intronic
912390656 1:109300382-109300404 GAGGAGGCCCAGAGGGAAGGCGG + Intronic
912937461 1:114016120-114016142 GCGGAAGGCAAAAGGGAAGCAGG + Intergenic
912942812 1:114059992-114060014 GCAGAAGGCCAACGGGAAGCAGG - Intergenic
913090524 1:115473740-115473762 GGTGAGATCCAGAGAGAAGCAGG + Intergenic
914196859 1:145452157-145452179 GGTGCGGGCCAGCGGGCAGCTGG - Intergenic
914717869 1:150266849-150266871 GCAGAGGGCCTGAGGTGAGCAGG - Intronic
914764307 1:150624503-150624525 GCTAAGGCCCAGAGGTAGGCTGG + Intronic
914803989 1:150979378-150979400 GCCGAGGGCCAGGGGGACCCCGG + Intergenic
914922821 1:151859139-151859161 GCTAAGGGTCAGAGGCAAGCTGG + Intergenic
916189886 1:162168429-162168451 GCTGAGGACCAAAGAGAAACAGG - Intronic
918001616 1:180502503-180502525 GCTGTTGGCCGGAGGGAAGCCGG - Exonic
918569723 1:185975362-185975384 GCAGAAGGCAAAAGGGAAGCAGG + Intronic
919896537 1:202012804-202012826 GCTGGGAGCCAGAGGGAACAAGG - Intronic
920111605 1:203591149-203591171 GCAGAGGAACAGAGGGAAGAAGG + Intergenic
920180465 1:204129265-204129287 GCGGAGGGCCGGAGGGCAGAGGG - Intergenic
920206998 1:204299473-204299495 GCTAAGGTCCATAGGGAAGGTGG + Intronic
920260469 1:204685053-204685075 GCCGAGGGGCAGAGGGACGGAGG - Intronic
920560687 1:206936338-206936360 GCTGAGATCCAGAGAGAAGCAGG + Intronic
920851455 1:209630799-209630821 GCAGAGGGTCAGAGGGCAGTGGG - Intronic
920982584 1:210852234-210852256 GCAAAGGCCCAGAGGGAAGGAGG + Intronic
921091619 1:211848850-211848872 GGTGAGGGCAAAAGGGGAGCAGG - Intergenic
921151912 1:212409495-212409517 GCTGAGGGCCAGAGAAAAAGGGG + Intronic
921325479 1:213983366-213983388 GCTGAGGGCGTGAAGGCAGCAGG + Intronic
921605070 1:217142098-217142120 GCTGAGGGCCTGAAGGAAACAGG - Intergenic
922912685 1:229230617-229230639 GCAGAGGGCCCGAGAGCAGCAGG - Intergenic
923933128 1:238726491-238726513 ACTGAGGCCCAGTGGGGAGCTGG - Intergenic
924947779 1:248857785-248857807 GGTGAGAGCCAGAGGGAAGAGGG - Intronic
1062835217 10:631007-631029 GCTGAGCTCCAGGGGAAAGCGGG + Intronic
1063621437 10:7652361-7652383 ACTGAGCTCCAGAGGCAAGCAGG + Intronic
1064080294 10:12302765-12302787 GATGAGGGTAAGAGGGAAGGTGG - Intergenic
1065796230 10:29310968-29310990 CCTGAGGATGAGAGGGAAGCAGG - Exonic
1065797217 10:29318736-29318758 GCTCAGGGGCAGACGGAAACAGG + Intergenic
1065945938 10:30605597-30605619 GCTCAGGGGCAGACGGAAACAGG - Intergenic
1065971591 10:30810178-30810200 GCTCAGCGGCAGCGGGAAGCTGG - Intergenic
1067282842 10:44885949-44885971 GCTCAGGACTAGAGGGAGGCAGG - Intergenic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1069546714 10:69334427-69334449 GCTGAGGCCCAGAGGGACAGAGG - Intronic
1069615726 10:69805040-69805062 GCTGGGGGCCAGAGGGAATTGGG + Intronic
1069875608 10:71561217-71561239 ACTGAGGGCCAGAGTGAAAACGG - Intronic
1069949606 10:72009888-72009910 CCTGAGGGCTTGAGGGAGGCTGG + Exonic
1070409363 10:76125250-76125272 GTGGAGGGCTAGGGGGAAGCTGG + Intronic
1070570088 10:77634554-77634576 GCTGGAGTCCAGAGGAAAGCAGG - Intronic
1070615525 10:77966765-77966787 ACTGAGGCCCAGAGGGATGTGGG + Intergenic
1070666738 10:78350412-78350434 GCTGTGGGGCAGAGGGGAGAGGG - Intergenic
1070800477 10:79242310-79242332 GCTGGCGGCAGGAGGGAAGCCGG - Intronic
1070811627 10:79301014-79301036 GCTGAGGACCAGAGTGGGGCAGG - Intronic
1070948421 10:80411742-80411764 ACTGAGGGCCTGAGGCAAGGAGG + Intronic
1071006968 10:80894621-80894643 GCTGAGGTCCAAAGGCAACCAGG + Intergenic
1071138085 10:82474936-82474958 ACTGCAGGCCAGAGGGCAGCGGG + Intronic
1071492345 10:86144421-86144443 GCTGAGGGTCAGTGGGCACCAGG + Intronic
1072189247 10:93066875-93066897 ACTGAGGCCCAGAGTGAAGAGGG - Intronic
1072806897 10:98429551-98429573 GGTGAGGACCGGAGGAAAGCAGG - Exonic
1072890051 10:99315947-99315969 GCTGAGGGTCCGAGAGCAGCAGG - Intergenic
1073036069 10:100565021-100565043 GCTGAGTTCCAGAGGGAAGGGGG + Intergenic
1073069936 10:100787013-100787035 TATGAGGGCCAGAGGGAACATGG + Intronic
1073082958 10:100871444-100871466 GATGAGGGCCGGAGGGAGGGTGG - Intergenic
1073500378 10:103931754-103931776 CCTGAGGGCATGAGGGAAGCAGG - Intergenic
1074533476 10:114312503-114312525 ACTGAGGCCCAGAGGGAATGGGG - Intronic
1074919323 10:117991370-117991392 GCAGAGGGGCAGAGGGAAGGAGG + Intergenic
1075048064 10:119161726-119161748 GCTCTGAGCCAGAGGCAAGCCGG - Intronic
1075212341 10:120501957-120501979 GCAGAGGGGCAGAGAGCAGCTGG + Intronic
1075647197 10:124104416-124104438 CCTCAGGGCCAGCGGGCAGCAGG + Intergenic
1075871345 10:125774215-125774237 GCTGCCGGCCAGCGGGGAGCTGG - Exonic
1076090394 10:127680633-127680655 GGTGAGGACCAGATGGTAGCTGG + Intergenic
1076236551 10:128868093-128868115 GCAGAGGGCAAGAGGGAAGGTGG + Intergenic
1076502696 10:130949704-130949726 GGTGCGGGGCAGAGGGAGGCTGG - Intergenic
1076530262 10:131140320-131140342 GCTCAGGGCCACTGGGCAGCAGG - Intronic
1076773295 10:132678985-132679007 TGTGAGGGCCAGAGGACAGCTGG + Intronic
1076807729 10:132867339-132867361 GCTGCGGGTCAGAGGGATTCTGG + Intronic
1077062418 11:623736-623758 GCAAAGGGCAACAGGGAAGCCGG + Intronic
1077105220 11:839235-839257 GCTGGGGGCCAGAGGGTAGGAGG + Intronic
1077190514 11:1254263-1254285 GCTGAGGGCGCGGGGGCAGCGGG - Exonic
1077329525 11:1977907-1977929 GATGGGGGCCACAGGGAGGCTGG - Intronic
1077539676 11:3140640-3140662 GCTGGGGGACAGAGGGGAGCCGG - Intronic
1077872086 11:6270892-6270914 GGTGAGGGTGAGAAGGAAGCTGG + Intronic
1077892630 11:6430518-6430540 GCTGTGTGTCAGAGGCAAGCTGG - Intergenic
1077943159 11:6865905-6865927 GGTGGGGACAAGAGGGAAGCAGG - Intergenic
1078175014 11:8964020-8964042 GCTGAGGGCGAGAGTGCCGCCGG + Intronic
1079100316 11:17537533-17537555 GCTGAGGACCAGTGGAAAGGTGG - Intronic
1079158857 11:17974186-17974208 CCTGAGGGACAGATGGGAGCAGG - Intronic
1080416399 11:32073363-32073385 GCAGAGGCCCTGAGGGGAGCAGG - Intronic
1080746924 11:35116493-35116515 ACTGAGGCCCAGAGGGATGAAGG - Intergenic
1080945783 11:36972454-36972476 GCCCAGGGCGATAGGGAAGCAGG - Intergenic
1081558434 11:44189513-44189535 GCGGAAGGCAAAAGGGAAGCTGG + Intronic
1081620968 11:44619014-44619036 GCGGAGAGTCAGAGGGAGGCTGG - Intronic
1081749551 11:45500146-45500168 AGAAAGGGCCAGAGGGAAGCAGG - Intergenic
1083322047 11:61853928-61853950 GATGAGGGCCTGGGGGATGCCGG - Intronic
1083326567 11:61876076-61876098 GCTGGGGGCCAGTGGGAGGTGGG - Intronic
1083334558 11:61915113-61915135 GATGAGGGGCAGTGAGAAGCTGG - Intronic
1083403480 11:62440704-62440726 GCAGAGAGCCAGAGGGAGCCTGG + Intronic
1083626705 11:64075555-64075577 GCTGAGGGAAGGAGGGCAGCAGG - Intronic
1083742508 11:64718334-64718356 GAGGAGAGCCAGAGGGAGGCCGG - Intronic
1084192900 11:67506871-67506893 GATGAAGGCCAGGGAGAAGCGGG + Exonic
1084288626 11:68147484-68147506 GCTGGGGGCCAGGAGGAAGTTGG + Intergenic
1084291138 11:68168812-68168834 GCTGAGAGCCAGAGGGTAAAAGG - Intronic
1084351350 11:68602200-68602222 ACTGAGGTCTAGAGGGAAGAAGG + Intronic
1084359899 11:68662447-68662469 GCTGAGATCCAGAGGGAAGTGGG + Intergenic
1084436457 11:69144339-69144361 GATGGGGGGCACAGGGAAGCAGG + Intergenic
1084700691 11:70784725-70784747 GCTGAGGTCCAGGGAGATGCTGG + Intronic
1084942495 11:72620438-72620460 ACTGAGGCCCAGAGAGTAGCAGG + Intronic
1084954193 11:72682915-72682937 GCTGGGGGGCAGAGGGGAGAGGG - Intergenic
1085402941 11:76245455-76245477 GCTGAAGCCCAGAGGGTAGGAGG + Intergenic
1085769389 11:79311387-79311409 GGTGAGTGCCATAGGGAACCAGG - Intronic
1086041545 11:82485612-82485634 ACTGAGGCCCAGAGAGGAGCAGG - Intergenic
1086589424 11:88494609-88494631 GCGGAAGGCAAGGGGGAAGCAGG - Intergenic
1086916102 11:92531671-92531693 GCTGAGCCCCAGAGGAAGGCTGG - Intronic
1087484789 11:98747888-98747910 ACTGAGGGCCAGAGGGTAGCTGG + Intergenic
1087548860 11:99620707-99620729 GCTGATGGCCGGGGGGGAGCGGG - Intronic
1089350127 11:117817320-117817342 GGTGAGGGCCCAAGGGAAACTGG - Intronic
1089453285 11:118611052-118611074 GCCGCGGGCCAGATGGAAGCGGG + Intronic
1089539797 11:119182949-119182971 GCTGCTGGCCAGTGGGAGGCAGG - Intronic
1090346407 11:126075192-126075214 CCTGGGGGCCAGAGAGAGGCTGG + Intergenic
1090588116 11:128236213-128236235 GATGAGGCCCAGAGGTAAGGGGG - Intergenic
1090914436 11:131150684-131150706 GCTGTGGGGCAGAGGAGAGCTGG + Intergenic
1091225230 11:133953130-133953152 AGTGAGGGCCAGAGTGATGCTGG + Intronic
1091239624 11:134043794-134043816 GCTGAGGGCTAGAGGAAGGAAGG + Intergenic
1091339757 11:134801162-134801184 GCTGCGGGCGAGAGGGACGCTGG + Intergenic
1202812504 11_KI270721v1_random:33086-33108 GATGGGGGCCACAGGGAGGCTGG - Intergenic
1091705676 12:2691498-2691520 GGTGAGGGCGCGCGGGAAGCCGG - Intronic
1092114789 12:5992347-5992369 GCTGAGGGAAGGAGGGAAGAGGG - Intronic
1092244529 12:6856231-6856253 GCTGAAGGCCAAGGGGAAGAGGG + Intronic
1092262559 12:6960315-6960337 GCAGAGGGACAGTGGGAAGGTGG - Intronic
1092600726 12:10060548-10060570 GGTGAAGGCAAGAGGGAAGTGGG + Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1094171262 12:27494817-27494839 GCAGAAGGCCAAAGGGAAGGAGG - Intronic
1095300682 12:40580967-40580989 GCAGAAGGCCAAAGAGAAGCAGG + Intergenic
1095612741 12:44149220-44149242 GCTCTGGGGCAGAAGGAAGCTGG + Intronic
1096418760 12:51437547-51437569 GCAGAAGGCAAAAGGGAAGCTGG - Intronic
1097086157 12:56469825-56469847 GCAGAGGGACTGAAGGAAGCAGG - Exonic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1098655227 12:73019748-73019770 GCAGAAGGCAAAAGGGAAGCTGG - Intergenic
1100616292 12:96234186-96234208 ACTGAGTGCCACAGGGAAGCTGG - Intronic
1100870345 12:98904256-98904278 GGTGAGGGCAAGAGTGAAACAGG + Intronic
1101051938 12:100873045-100873067 GCAGAAGGCAAAAGGGAAGCAGG - Intronic
1101243924 12:102866524-102866546 GATGAGGGCAAGGGAGAAGCAGG + Intronic
1101733846 12:107448103-107448125 AATGAGGCCCAGATGGAAGCGGG + Intronic
1101777116 12:107805714-107805736 GCTGAGGTCCAGAGGAGGGCAGG - Intergenic
1101839891 12:108320583-108320605 GCTGAGGGGAAGATGGAAGAAGG - Intronic
1101958624 12:109231704-109231726 GGTGAAGTCCAGAGGAAAGCAGG + Intronic
1102187219 12:110958132-110958154 GATGAGGGAGTGAGGGAAGCGGG - Intergenic
1102196049 12:111025794-111025816 GCTCAGGGCAGGAGAGAAGCAGG - Intergenic
1102383375 12:112486159-112486181 GCTGAGTGCCACAGGGATGCAGG + Intronic
1102666861 12:114581524-114581546 GCAGAAGGCGAAAGGGAAGCAGG + Intergenic
1103185813 12:118956183-118956205 GGGGAGGGCCAGAGGGAGGTAGG + Intergenic
1103323163 12:120103241-120103263 GCTGCAGGCCGGGGGGAAGCTGG - Intronic
1103361016 12:120353676-120353698 GATGAGGACAGGAGGGAAGCAGG - Intronic
1103521082 12:121537406-121537428 GCCGAGGCCCAGGCGGAAGCCGG - Intronic
1103976024 12:124703282-124703304 TCTGAGAGCAGGAGGGAAGCTGG + Intergenic
1104053793 12:125214277-125214299 GCTGAGAGACAGAGGGAGGCTGG - Intronic
1104149710 12:126070874-126070896 GCTGAGGGCCAGAGGTAAAGAGG + Intergenic
1104588300 12:130064576-130064598 GATGAGGGACAGAGGGAACAGGG + Intergenic
1104622015 12:130321691-130321713 TCTGAGGGCAAGTGGGAGGCAGG + Intergenic
1104950621 12:132438252-132438274 GCAGAGCTCCAGAGAGAAGCTGG - Intergenic
1105284979 13:18996204-18996226 GCAGAGGGCCAGAGGGCAAAAGG + Intergenic
1106353512 13:28956944-28956966 GTTGGGGGACAGAGGGAAGAAGG + Intronic
1106464205 13:29998328-29998350 GGTGAGGGCAAAGGGGAAGCGGG - Intergenic
1106720749 13:32432365-32432387 GCTGAGGGGAAGGGGGAAGGGGG + Intergenic
1106869621 13:34004725-34004747 GCTGAGTGCCAAGGAGAAGCTGG - Intergenic
1107452377 13:40521508-40521530 GCTGACGGCCAGAAAGAAGATGG + Intergenic
1107577592 13:41744026-41744048 CCTGAGGGAGAAAGGGAAGCAGG - Intronic
1107622002 13:42243170-42243192 TGTGAGGGCAAGAGGGAAGTAGG - Intronic
1107982800 13:45749458-45749480 GCCGAGGGACAGAGGGGTGCAGG - Intergenic
1107991879 13:45825949-45825971 GTTGAGGGCCAGGGGGAGGAAGG - Intronic
1108445180 13:50501463-50501485 GCAGAAGGCAAAAGGGAAGCAGG + Intronic
1109968502 13:69734250-69734272 GCAGAAGGCCAGGGGGGAGCAGG - Intronic
1112742108 13:102486675-102486697 GCTGAAGGCCTGAGAGAACCTGG - Intergenic
1113502432 13:110787105-110787127 GCGGAAGGCAAAAGGGAAGCAGG - Intergenic
1113638953 13:111943644-111943666 GGTGAGGGCCCCAGGGAGGCAGG + Intergenic
1114458346 14:22871829-22871851 GCGGAGCGCGACAGGGAAGCGGG - Exonic
1114484969 14:23056949-23056971 GCTGGGGACCAGAGAGAAGGCGG + Intronic
1114664591 14:24370117-24370139 GCCGAGGGCCAGAGGATAGCTGG + Exonic
1114848167 14:26349030-26349052 GCAGAAGGCAAGAGGGGAGCAGG - Intergenic
1115029298 14:28774981-28775003 GTTGTTGGCCAGAGGGAGGCCGG + Intronic
1115031530 14:28801444-28801466 GCAGAGCGCCAGAGGAAAGCAGG + Intronic
1115271865 14:31561557-31561579 GCTGCAGGGCAGGGGGAAGCGGG + Intronic
1115831775 14:37350708-37350730 GTTGAGGGCTGGAGGGAAGTGGG - Intronic
1116061959 14:39935056-39935078 GCTGAGGACCAGGGTGAAGGAGG - Intergenic
1117209560 14:53481470-53481492 GCAGAGTGCCAGAGTGAAGGAGG - Intergenic
1117729949 14:58712468-58712490 TCTGAGACCCAGAGGGAAGGCGG - Intergenic
1117748852 14:58899884-58899906 GCTGAGGGCCTCAGTGAAACTGG - Intergenic
1118157890 14:63258585-63258607 GCTGTTGGGGAGAGGGAAGCTGG - Intronic
1118282509 14:64442441-64442463 GCTGACGGCCAAAAGGAAGTTGG + Intronic
1118372665 14:65150813-65150835 GTTGAGGGCCAGGGGGTAGGAGG - Intergenic
1118699173 14:68416318-68416340 AGTGTGGGCCAGAGGGAAGAGGG - Intronic
1119033057 14:71207413-71207435 GTTGAGAGCCAGAAGGAACCAGG - Intergenic
1119197284 14:72726456-72726478 GCTGATGGGCAGAGGGAGGATGG - Intronic
1119235766 14:73017967-73017989 GAAGAGGTGCAGAGGGAAGCAGG - Intronic
1119328370 14:73775784-73775806 TCTGAGGGCAAGACGGGAGCTGG + Intronic
1119428716 14:74552041-74552063 GCTGAGGGCCAGGAGAAAGAGGG + Intronic
1119657949 14:76430938-76430960 GCTGCTGGTCAGAGGGCAGCAGG - Intronic
1120073000 14:80124149-80124171 GCAGAAGGCCAAAGGGGAGCAGG - Intergenic
1120299748 14:82691563-82691585 GCTAAGGCCCAGAGGTAGGCTGG + Intergenic
1120509964 14:85401293-85401315 GCTGAGGACTACAGGAAAGCCGG + Intergenic
1120813518 14:88829105-88829127 GGTGAGGGACAGAGGCCAGCCGG + Intronic
1121421534 14:93819044-93819066 GATGAGGACCAGAGTGATGCTGG - Intergenic
1121575115 14:94978323-94978345 ACTGAGGGTTGGAGGGAAGCAGG - Intergenic
1121718747 14:96094897-96094919 ACTGTTGGCCATAGGGAAGCAGG + Intergenic
1121774368 14:96580859-96580881 GCTGGGTTCCAGAGGGATGCAGG - Intergenic
1121775332 14:96587046-96587068 GCTCAGGGCCAGGGGGAAGCTGG + Intergenic
1121960331 14:98253660-98253682 GCTAAGGGCTGGAGGGAAACTGG - Intergenic
1122152374 14:99731994-99732016 TCTCAGGGCCAGAGGGCAGAGGG + Intergenic
1122283709 14:100638808-100638830 GCTGAGGCCCAGCAGGCAGCGGG - Intergenic
1122296381 14:100708613-100708635 GCTGAGGGCCAGCGAGCAACTGG + Intergenic
1122322818 14:100865883-100865905 GCTGTGGGACAGAGGCAGGCGGG + Intergenic
1122325789 14:100880079-100880101 GCTCAGGGCAAGAGGAAGGCGGG + Intergenic
1122536095 14:102464089-102464111 GCTGAGGGCCACACGGCAGGAGG - Intronic
1123070921 14:105642153-105642175 CCTGAGGCCCAGAGGGCAGGAGG + Intergenic
1123090586 14:105740437-105740459 CCTGAGGCCCAGAGGGCAGGAGG + Intergenic
1123096216 14:105768187-105768209 CCTGAGGCCCAGAGGGCAGGAGG + Intergenic
1124881225 15:33644640-33644662 TCTGAGGGCCAGAGGGGAGGTGG - Intronic
1125327376 15:38549646-38549668 GCAGAGGGGAAGAGGGAAGCAGG - Intronic
1126580959 15:50242274-50242296 GCAGAGGGCAACAGGGCAGCTGG + Exonic
1126785421 15:52174577-52174599 GATGAGGGCCAAAGGGATGGAGG + Intronic
1126785664 15:52176209-52176231 GCTGAGAGCCTGGGGGAAGGTGG - Intronic
1126918003 15:53487368-53487390 GCTGAGAGCCAAAGGGAACATGG - Intergenic
1127760720 15:62136875-62136897 GCTGATGGGCAATGGGAAGCAGG + Intergenic
1127921980 15:63501598-63501620 CCTCAGTGCCAGAGGGATGCGGG + Intergenic
1127961655 15:63894968-63894990 GCTGAGGGAGAGAGGGGAGGTGG - Intergenic
1128112483 15:65085485-65085507 GCTGAGGGTCAGAGGGGACAGGG - Intergenic
1128133488 15:65246106-65246128 GCCGAGGCCCTGAGAGAAGCAGG - Intronic
1128290552 15:66475419-66475441 GCAGAGTGACACAGGGAAGCTGG - Intronic
1128449489 15:67796423-67796445 GCAGAAGGCAAGAGGGGAGCTGG + Intronic
1128458245 15:67845323-67845345 ACTGAGAGCTAGAGAGAAGCTGG - Intergenic
1128711928 15:69878588-69878610 GGTGTGAGCCAGAGGGGAGCGGG + Intergenic
1128984256 15:72207732-72207754 GCTGAAGGCAAGAGGGAATGTGG + Intronic
1129165139 15:73772794-73772816 ACTGAGGCCCAGAGAGGAGCGGG + Intergenic
1129522452 15:76194448-76194470 CCTGAGGGACACAGGGAACCAGG - Intronic
1129659068 15:77543065-77543087 ACTGAGGCCCAGAGAGAGGCAGG - Intergenic
1129669396 15:77598727-77598749 GCTGCTGGTAAGAGGGAAGCCGG + Intergenic
1129732501 15:77940182-77940204 GCAGAGGAACAGAGGGAGGCGGG - Intergenic
1129828554 15:78651831-78651853 GCTAAGGGGCTGAAGGAAGCAGG - Intronic
1129986521 15:79923732-79923754 GCGGAGGGACGGAGGGAAGATGG - Exonic
1130353180 15:83108597-83108619 GCTGAAGGCCTGAGGGTCGCCGG + Intronic
1130912929 15:88283360-88283382 ACTGAGGTCCTGAGAGAAGCTGG - Intergenic
1131095084 15:89649530-89649552 GAGGTGGGCCAGTGGGAAGCCGG - Intronic
1131908389 15:97169207-97169229 GCTGAGGCCCAGAGAGGAGATGG + Intergenic
1132289058 15:100686577-100686599 GTCAAGGCCCAGAGGGAAGCGGG + Intergenic
1132303527 15:100791097-100791119 GCTGAGGGGAAGAGGGAATGTGG + Intergenic
1132606700 16:796651-796673 GCTCAGGGCCAGAGAGCCGCCGG - Intronic
1132699380 16:1215855-1215877 GTGGAGAGCCAGAGGGATGCAGG + Intronic
1132716100 16:1290553-1290575 GCTGAGGGGCAGAAGGCAGAAGG + Intergenic
1132867942 16:2103104-2103126 GCTGGGGGCCACGGAGAAGCAGG - Intronic
1133016336 16:2943326-2943348 GGTGAGGGCCGGAGGAAACCAGG - Intronic
1133537958 16:6720313-6720335 GCAGAAGGCAAAAGGGAAGCTGG - Intronic
1134046170 16:11102899-11102921 CCTGAGGGCCAGAGGGGAGACGG + Intronic
1134187591 16:12096910-12096932 GCTGAGGTCCAGAGGGTCACAGG + Intronic
1134257891 16:12626582-12626604 GATGAGGGCCAGGGGGAAGCTGG - Intergenic
1134523827 16:14930010-14930032 GCTGGGGGCCACGGAGAAGCAGG + Intronic
1134549076 16:15130925-15130947 GCTGGGGGCCACGGAGAAGCAGG - Intronic
1134624701 16:15715127-15715149 GCTGGGGGCTCGAGGGAGGCTGG + Intronic
1134711418 16:16328495-16328517 GCTGGGGGCCACGGAGAAGCAGG + Intergenic
1134719269 16:16371794-16371816 GCTGGGGGCCACGGAGAAGCAGG + Intergenic
1134880885 16:17744942-17744964 GCTGAGTGCCAAAGGGAGACTGG + Intergenic
1134948157 16:18340091-18340113 GCTGGGGGCCACGGAGAAGCAGG - Intergenic
1134955411 16:18380198-18380220 GCTGGGGGCCACGGAGAAGCAGG - Intergenic
1135042653 16:19129890-19129912 GCTGAGGGGCAGAAGGCAGAAGG - Intronic
1135864391 16:26087488-26087510 GCTGAGGGAGTGAGGGAGGCAGG - Intronic
1135927094 16:26705022-26705044 GCTTAGGGCCAGAGGAAAGGTGG + Intergenic
1136080272 16:27847815-27847837 GCAGAGGGCGAAGGGGAAGCAGG - Intronic
1136397855 16:30002827-30002849 GCTGAGGGGCAGAGCGGAGTGGG + Intronic
1137222960 16:46473702-46473724 GCGGAGGGCCAGAGACAAGAGGG + Intergenic
1137584688 16:49657394-49657416 GCTGAGGGACAGAGGAACTCAGG + Intronic
1137613699 16:49835139-49835161 GCTGAGGGCCTCAGAGAAGAGGG - Intronic
1138463919 16:57173029-57173051 TCTGAGGTCCAAAGGGAAACTGG - Intronic
1138514647 16:57529281-57529303 CCGGTGGCCCAGAGGGAAGCGGG - Exonic
1138776936 16:59734584-59734606 GCAGAAGGCAAAAGGGAAGCAGG - Intronic
1140481366 16:75264679-75264701 GCAGATGACCAGAGGGAAGCTGG - Intronic
1141841858 16:86578800-86578822 GGCGAAGGCCAGAGGGAGGCCGG - Exonic
1142056068 16:87996693-87996715 GCTGAGGACCAGAGCCCAGCCGG - Intronic
1142112663 16:88340614-88340636 GCTGAGGCCCAGAGGGAGGAAGG + Intergenic
1142123927 16:88400882-88400904 GCAGAGGGCCAGGGGGTGGCGGG + Intergenic
1142225195 16:88873751-88873773 GCCGAGGGCCACAAGGAATCAGG - Intergenic
1142702581 17:1673041-1673063 GCAGAGGACAAGAGGGAAGCTGG + Intronic
1142891772 17:2948508-2948530 GCTGTGGACCAGGGGGAGGCAGG + Intronic
1142891803 17:2948646-2948668 GCTGTGGACCAGGGGGAGGCAGG + Intronic
1142891833 17:2948784-2948806 GCTGTGGACCAGGGGGAGGCAGG + Intronic
1143029921 17:3962218-3962240 ACTGAGGCCCAGAGAGGAGCAGG + Intronic
1143407434 17:6686704-6686726 GAGGAGGTCCACAGGGAAGCTGG - Intronic
1143506647 17:7369646-7369668 GGAGAGGGCGAGGGGGAAGCAGG - Intergenic
1143619876 17:8074673-8074695 GTTAAGGGCCAGAGGGATCCAGG - Intronic
1144485315 17:15659732-15659754 GCTCAGGGCCTCAGGGGAGCCGG - Intronic
1144810104 17:17993603-17993625 GCTGAGCTCCAGAGGGAACCAGG + Intronic
1144998049 17:19284371-19284393 GTTCAGGGCCTGATGGAAGCTGG + Intronic
1145996170 17:29106223-29106245 GCTGAGGGCCTGTGAGAAGGGGG + Intronic
1146216773 17:30982721-30982743 GTTTAGGGCCAGAGAGAAGTGGG - Intronic
1146547536 17:33751862-33751884 GCTGAGAGGCAGCGGGAGGCTGG + Intronic
1146789675 17:35744194-35744216 GCTGGGGGGCAGGGGGAGGCAGG + Intronic
1146929837 17:36769131-36769153 CCTTATGGCCAGAGGGAATCTGG + Intergenic
1147045321 17:37746941-37746963 GCTGAGAGCCAGAAGGAAGCGGG + Intergenic
1147157115 17:38549587-38549609 GGTGAGGGGCAGTGGGAAGGAGG - Intronic
1147213729 17:38887113-38887135 GGGGAGGGCTAGAGGCAAGCAGG - Intronic
1147254396 17:39173575-39173597 GCTCAGGGCCAGTGTGGAGCTGG + Exonic
1147421112 17:40322607-40322629 GGCGAGGGACAGAGGGAAGGAGG - Intronic
1147519273 17:41153981-41154003 GCTCTGGCACAGAGGGAAGCAGG + Intergenic
1147728274 17:42580457-42580479 GCTGATGGCCAGATGGACCCAGG + Exonic
1147768176 17:42850790-42850812 GCTGGGGGCCAGAGGGCAAGGGG + Intergenic
1148157569 17:45432504-45432526 TCTGGGGGCTGGAGGGAAGCAGG - Intronic
1148689311 17:49517691-49517713 GCGGAAGGCGAAAGGGAAGCAGG - Intergenic
1148868045 17:50639364-50639386 CCTGAGGGCCAGAGAGATACGGG + Intronic
1149222354 17:54429574-54429596 GCAGAGGGCAGGAGGGAACCAGG + Intergenic
1149340382 17:55680055-55680077 GCTCAGAGCAAGAGGGAAGGGGG - Intergenic
1149552699 17:57551963-57551985 GCTGAGGGATCCAGGGAAGCTGG - Intronic
1150391410 17:64791778-64791800 GCTGAGGGTGAGAGGGAGACAGG - Intergenic
1151761263 17:76104406-76104428 GCTGGGGGCCAGAGGCAGGGTGG - Intronic
1151788153 17:76286486-76286508 GCTGAGGGACAGAAGGGAACAGG + Intronic
1151963875 17:77421240-77421262 GCTGAGGGACTGAAGGAAGAGGG - Intronic
1152247530 17:79192927-79192949 CCTGACCCCCAGAGGGAAGCAGG + Intronic
1152500450 17:80705097-80705119 GCCCAGGGCCACAGGGAAGGAGG - Intronic
1152535292 17:80947338-80947360 GCTGACGGCCACAGGTGAGCGGG + Exonic
1152699663 17:81812705-81812727 CCTCAGGGCCAGAGGGCAGCTGG + Intronic
1152738423 17:82008628-82008650 GCTGTGGCCAAGAGGGCAGCGGG + Intronic
1152811692 17:82385557-82385579 GCTGTGGGCTTCAGGGAAGCGGG - Intergenic
1152821629 17:82440520-82440542 GCTGACGGCCAGAGGGCAGGAGG - Intronic
1153416037 18:4846651-4846673 GCTGAGTTGCAGAAGGAAGCAGG - Intergenic
1153872612 18:9334700-9334722 GCGGAGGGGAAGAGGGGAGCAGG + Intergenic
1153909994 18:9698350-9698372 GCTGTGGGCCCGAGGGGAGAAGG - Intergenic
1155229276 18:23757344-23757366 GCTGGAGGCCTGAGGGAAGTGGG - Intronic
1155368363 18:25071961-25071983 GCTGAGAACCAGAGGGCAGAAGG + Intronic
1156447574 18:37248830-37248852 CCTGAGTGCCACAGGGGAGCAGG - Intronic
1156731442 18:40197981-40198003 GCTTGGGGACAGAGGGAGGCGGG - Intergenic
1157469730 18:47979861-47979883 GCAGAGGGCCAAAGGCAGGCTGG - Intergenic
1157680000 18:49597650-49597672 GCTCAGGCCCAGAGGCCAGCTGG + Exonic
1157685761 18:49641066-49641088 GGGCAGGGCCAGAGTGAAGCTGG + Intergenic
1157710602 18:49847331-49847353 GCTGCAGGCCTGAGGGTAGCGGG + Intronic
1157711926 18:49856123-49856145 GCTGAGGGCCAGTGGGTTTCAGG + Intronic
1158187147 18:54783730-54783752 GCCTATGCCCAGAGGGAAGCAGG - Intronic
1159114876 18:64102713-64102735 GCGGAGGGCAAAGGGGAAGCAGG + Intergenic
1159986221 18:74844356-74844378 TCTGAAGTCCTGAGGGAAGCTGG - Intronic
1160027948 18:75234191-75234213 CCTGTGGGCCAGAGAGAAACGGG + Intronic
1160115796 18:76078268-76078290 ACTCAGGGCCAGAGGACAGCAGG + Intergenic
1160158818 18:76455441-76455463 GCTCAGGGACAGATGGAGGCTGG + Intronic
1160172530 18:76566902-76566924 TGTGAAGGCCAGAGGGAAGCAGG - Intergenic
1160522469 18:79515713-79515735 GCAGAGGGACAGGAGGAAGCGGG + Intronic
1160710655 19:549569-549591 GCTGAGGGGACGAGGGGAGCAGG - Intronic
1160853112 19:1203704-1203726 GCTAAGGGCAAAAGTGAAGCAGG + Intronic
1161099391 19:2413860-2413882 GGTGGGGGCCAGAGGCATGCTGG - Exonic
1161199321 19:3005801-3005823 GCTGACGGCCAGGGCGTAGCAGG + Exonic
1161361125 19:3850311-3850333 GCTGAGGGACAGAGGTTATCAGG + Intronic
1161763698 19:6193927-6193949 GCGGAGGGCAAAAGGGGAGCAGG + Intronic
1161993407 19:7698275-7698297 ACTGAGGCCCAGAGAGGAGCGGG + Intronic
1162217437 19:9148063-9148085 GCAGAAGGCAAAAGGGAAGCAGG - Intronic
1162481456 19:10929134-10929156 GCTGGGCGCCAGCGTGAAGCAGG - Exonic
1162764374 19:12909490-12909512 GCAGAGGGACAGAGAGAAGCTGG - Intronic
1162963398 19:14142512-14142534 GCTGAAGTCCAGAGGAAACCAGG - Intergenic
1163032140 19:14551715-14551737 GCTGTGGGGCAGAGGCCAGCGGG + Intronic
1163148791 19:15399275-15399297 GCAGAGGGGTGGAGGGAAGCTGG + Intronic
1163402623 19:17103386-17103408 GCTGAGGGAGAGAGGGAAAAAGG + Intronic
1163427220 19:17246118-17246140 GGGGAGGGGCAGAGGGAGGCGGG - Intronic
1163484127 19:17576468-17576490 GCTGGGGGGTAGAGTGAAGCTGG + Intronic
1163685473 19:18709634-18709656 GCTGAGGTCCTCTGGGAAGCCGG + Intronic
1164510484 19:28892761-28892783 GCTGAGGGCAGGAGGGAAAGAGG - Intergenic
1164555743 19:29249476-29249498 GCTGAAGGTAAAAGGGAAGCAGG - Intergenic
1165375199 19:35437038-35437060 GATAAGGGCCAGAAGGCAGCTGG - Intergenic
1165386519 19:35513431-35513453 GCAGAGGGCCAGCAGGAGGCAGG + Exonic
1165432044 19:35778433-35778455 GCAGAGGGACAGAAGGGAGCAGG - Intronic
1165953596 19:39488483-39488505 TCTAAAGGCCAGAGGGAGGCAGG - Intronic
1166144783 19:40826403-40826425 GCTGAGGGGGAGTGGGAAGGAGG + Intronic
1166182959 19:41121804-41121826 GCTGAGGGGGAGTGGGAAGGAGG - Intronic
1166336388 19:42110575-42110597 GCTGGGGCCCAGAGGGAAAGTGG - Intronic
1166504213 19:43361423-43361445 GCTGGGGAGCAGAGGGAAGGTGG - Exonic
1166506246 19:43373335-43373357 GCTGGGGAGCAGAGGGAAGGTGG + Intergenic
1166631634 19:44412117-44412139 GGGGAAGGCCAGAGAGAAGCTGG - Intergenic
1166636542 19:44456504-44456526 GGGGAAGGCCAGAGAGAAGCTGG + Intergenic
1166698501 19:44867972-44867994 AGTGGGGGGCAGAGGGAAGCGGG + Intronic
1166721888 19:45001672-45001694 GCTGGGGGCCTTAGGTAAGCGGG + Exonic
1166750182 19:45160842-45160864 GCTGAGGGGCAGAGGAAACTGGG + Intronic
1166880925 19:45929484-45929506 GCAGAGGGACAGAGGGAGGGAGG + Intergenic
1166943486 19:46383296-46383318 GCTGAGGGCGAGGGAGAAGCAGG - Intronic
1166966355 19:46531502-46531524 TCTGAGGCCCCAAGGGAAGCAGG + Intronic
1167053463 19:47094521-47094543 CCGGAGGGCCTGAGAGAAGCCGG - Exonic
1167292337 19:48631076-48631098 ACTGAGGTCCAGAGGGACCCAGG + Intronic
1167568388 19:50271547-50271569 GTTGGGGGCCTGAGGGCAGCTGG + Intronic
1167600426 19:50451530-50451552 ACTGAGGTCCTGAGGGAAGAGGG + Intronic
1167666116 19:50823584-50823606 ACTGTGGGCCAGAGGGATGAGGG + Intronic
1168277792 19:55286740-55286762 GGTGAGGGCCAGGGGGTGGCTGG + Intronic
925075270 2:1011209-1011231 ACTGAGGGCCAGGTGGGAGCAGG + Intronic
925179651 2:1808757-1808779 GATGAGGGCCTGAGGGACACAGG + Intronic
925626346 2:5845407-5845429 GCTGAGGCACAGTGGGGAGCAGG + Intergenic
925742762 2:7020168-7020190 GCTGAGTGTCAGAGGCAAGCAGG + Intronic
926007791 2:9386038-9386060 GCTGAAGGACAGATGGAAGTGGG - Intronic
926085439 2:10016923-10016945 GCAGAGAGCCAGGGTGAAGCTGG - Intergenic
926095620 2:10079618-10079640 GCCGCGGGCCCGAGGGGAGCCGG + Intronic
926313898 2:11695695-11695717 GCGGGTGGCCAGAGGGAAGCTGG + Intronic
926853618 2:17228208-17228230 GCAGAAGGCAACAGGGAAGCAGG + Intergenic
927150591 2:20193158-20193180 GCCCAGGGCCAGAGGGCAGGAGG - Intergenic
927875896 2:26655100-26655122 GCTGAGGGAGGGAGGGAAGGAGG + Intergenic
928217596 2:29375235-29375257 GCTGAGGGTCAGTGAGAAGGTGG - Intronic
928849007 2:35719081-35719103 GCTGAGGGTGGGAGGAAAGCTGG + Intergenic
929040729 2:37742039-37742061 GCGGAAGGCGAAAGGGAAGCAGG - Intergenic
929599651 2:43197192-43197214 GGTGAGGGGCAAAGGGGAGCAGG - Intergenic
930104019 2:47626153-47626175 TCTGAGGTCCAGTGGGTAGCTGG + Intergenic
930979417 2:57504857-57504879 GTTGGGGGCATGAGGGAAGCAGG - Intergenic
931040082 2:58287595-58287617 ACTGAGCCCCAGAGAGAAGCTGG - Intergenic
931643110 2:64398682-64398704 GCTGAGGGAAGGAGGGAAGTGGG + Intergenic
932563451 2:72891423-72891445 GCTGAAGGCAAAGGGGAAGCTGG + Exonic
933069187 2:77836332-77836354 GCTGAGGGGCATAGGGCAGAGGG - Intergenic
933198072 2:79415281-79415303 GCAGAAGGCCAAAGGGGAGCAGG - Intronic
933727276 2:85434067-85434089 GCAGAGGGCCTGAGGGCATCAGG - Intronic
933919263 2:87028112-87028134 GCTGAGGGCCTGATGGTAGCTGG - Intergenic
934003731 2:87741795-87741817 GCTGAGGGCCTGATGGTAGCTGG + Intergenic
934494642 2:94787043-94787065 GCTCAGGGCCAGGGAGAATCTGG + Intergenic
934534292 2:95120432-95120454 GCTGGAGGCCAATGGGAAGCTGG + Intronic
934651313 2:96092672-96092694 CCAAAGGGCAAGAGGGAAGCTGG + Intergenic
934975599 2:98799932-98799954 GCTGAGGGTCAGGAGCAAGCAGG - Intronic
934979095 2:98825591-98825613 CTTGAGGGCCAGAAGGGAGCAGG + Intronic
935027077 2:99287101-99287123 GCTGATGGGGAGAGGGAAACTGG + Intronic
936721587 2:115257435-115257457 GCAGAAGGCAAGGGGGAAGCAGG + Intronic
937046843 2:118856195-118856217 ACTGAGGCCCAGAGAGCAGCGGG - Intergenic
937254731 2:120547146-120547168 ACTGAGGCCCAGAAGGAATCAGG + Intergenic
937340181 2:121086248-121086270 GGTGAGGGGCAGAAGGAAGGGGG + Intergenic
937350534 2:121157506-121157528 GCAGAAGGCAAAAGGGAAGCAGG - Intergenic
937589966 2:123601014-123601036 GCTGAAAGCCAGACGGAAACTGG - Intergenic
937983016 2:127625884-127625906 GCTGAGGCCCAGAGGCAGGCAGG - Intronic
938483675 2:131682204-131682226 GCTGAGGTCCAGAGGAGGGCAGG + Intergenic
938890399 2:135698723-135698745 GCAGAAGGCAAGAGGGAAGCAGG + Intronic
938986559 2:136581960-136581982 GGTGAGGGACAGAGAGAAGTTGG - Intergenic
939117849 2:138080971-138080993 GCTGAGGGCCTGATGACAGCAGG - Intergenic
940004441 2:148998296-148998318 TCTGAGGGACACAGGGAAGGAGG + Intronic
940849161 2:158672003-158672025 CTTGAGGAACAGAGGGAAGCCGG + Intronic
940910945 2:159209539-159209561 ACTGAGGGCCTCAGGGAAGCTGG - Intronic
940945815 2:159616080-159616102 GCGGAGGGCGAGAGGGCGGCGGG + Intronic
941738999 2:169012889-169012911 GCTAAGGGGCAGAGGGGAGTTGG + Intronic
941820532 2:169840245-169840267 GCTCAGGCCCAGAGGGAGGTGGG - Intronic
942139416 2:172963029-172963051 GCAGAGGGCAAAGGGGAAGCAGG + Intronic
942901220 2:181121585-181121607 TCAGAGGACCAGAAGGAAGCTGG + Intergenic
943725286 2:191245966-191245988 GCTGTGGGCCAGAGGAATGGAGG - Intronic
944666155 2:201961302-201961324 GCTCAGGGTTAAAGGGAAGCTGG + Intergenic
944667850 2:201971827-201971849 GATGACAGTCAGAGGGAAGCAGG + Intergenic
945064436 2:205936721-205936743 GCTGGGGGCCGGAGGGAAAGAGG + Intergenic
945868623 2:215203362-215203384 GCTGAAGGTCAGAGAGAAGTAGG - Intergenic
946192877 2:218016624-218016646 GCTGATGGCCAGGGGGACCCAGG + Intergenic
946398444 2:219455544-219455566 GCTTAGGGCCAGCTGGAGGCTGG + Intronic
946418902 2:219553941-219553963 GCTGGGGGCCAGAGGGCAATGGG + Intronic
947076223 2:226348897-226348919 GCAGAGGGCCAGAGCCAAACTGG + Intergenic
947526196 2:230878147-230878169 GAGGAGGGCCAGAGAGCAGCCGG - Exonic
947605055 2:231480901-231480923 GGGAGGGGCCAGAGGGAAGCTGG - Intronic
948757074 2:240166125-240166147 GCAGAAGGCAAAAGGGAAGCAGG - Intergenic
948867330 2:240782632-240782654 GCTGAGGCCCGGAGCGAAGCTGG + Intronic
949077319 2:242069188-242069210 GCTGAGGGGCACTGGGAAGGAGG - Intergenic
1168831335 20:846783-846805 ACTGAGGCCCAGAGGGAAACTGG - Intronic
1169074618 20:2752952-2752974 ACTCAGGGCTCGAGGGAAGCCGG + Intronic
1169187580 20:3631659-3631681 CCTGAGGCATAGAGGGAAGCAGG + Intronic
1169278674 20:4249547-4249569 GCTGAGGGCCAAGGGGGAGGGGG - Intergenic
1169918119 20:10704027-10704049 GCAGAGGGCGAAGGGGAAGCAGG - Intergenic
1170739597 20:19043635-19043657 ACTGAGGGCCAGATGGAATGAGG - Intergenic
1170791219 20:19511092-19511114 GCTGGGAGACAGAGGAAAGCAGG - Intronic
1171293441 20:23995591-23995613 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1172006393 20:31821566-31821588 GCAGAGAGCCAGAAGGAAGTGGG + Exonic
1172055120 20:32149606-32149628 GCGAAGGGCCAGAGTGAGGCTGG - Intronic
1172386976 20:34540876-34540898 ACTGAAGGTCAGAAGGAAGCTGG - Exonic
1172480863 20:35270585-35270607 GCAGAGAGCCAGAGGGCAGGAGG + Intronic
1172512073 20:35507812-35507834 ACTGGGGTCCAGAGGGGAGCAGG + Exonic
1172639569 20:36432595-36432617 GCTGAGGGTCAGAGTGGACCAGG - Exonic
1172696163 20:36824488-36824510 GCTGGGGGCAAGAGGGAAAGGGG + Intronic
1173086398 20:39923187-39923209 ACTGATGGCCAAAGGGAATCTGG + Intergenic
1173411664 20:42816684-42816706 GCAGAAGGCGAGGGGGAAGCAGG - Intronic
1174413862 20:50353911-50353933 GCGGGAGGCCAGAGGGGAGCAGG + Intergenic
1174670917 20:52306919-52306941 GATGAGGGCCAAAGAGAAGGAGG + Intergenic
1174960209 20:55147852-55147874 GCTGGGGGAGAGAGGGAAGTGGG - Intergenic
1175266019 20:57703993-57704015 ACCGAGGGCCAGAGGGATGGAGG - Intronic
1175379270 20:58551659-58551681 GCTCAGGGCTAGAGGGAATGGGG - Intergenic
1175460659 20:59149771-59149793 CCTGAGGGCCCCAGGGAATCCGG + Intergenic
1175668704 20:60882628-60882650 GCTGAGGGGGTGTGGGAAGCAGG - Intergenic
1175967452 20:62666575-62666597 GGTGAGGGCCAGATGGCACCTGG + Exonic
1176122051 20:63458384-63458406 GCCGAGGGCAGGAGGGGAGCAGG - Intronic
1176200685 20:63858938-63858960 TCTGAGGGGCAGAGGTCAGCGGG - Intergenic
1177739560 21:25136958-25136980 GCAGAAGGCCAAGGGGAAGCAGG + Intergenic
1178775356 21:35544963-35544985 GTTGAGGGACACATGGAAGCAGG - Intronic
1179050415 21:37884394-37884416 GCTGAGATGCAGAGAGAAGCTGG - Intronic
1179437680 21:41373569-41373591 GCTGAAGGGCAGAGGGGAGTTGG - Intronic
1179496327 21:41773602-41773624 GCTGAGGGACAGAGGGAATAGGG + Intergenic
1179827386 21:43973796-43973818 GCCCAGGGCCATGGGGAAGCAGG + Intronic
1180009903 21:45042786-45042808 GCTGAGGGCAATGCGGAAGCAGG - Intergenic
1180109491 21:45641555-45641577 GCAGGGGGCCAGAGGGACCCAGG - Intergenic
1180143489 21:45907041-45907063 GCTGAAGGCCAGGCGGAGGCCGG + Intronic
1180618262 22:17143035-17143057 CCTGAGGGCCAGAGAGGAGACGG + Intronic
1180911920 22:19456680-19456702 GGTGGGGGTGAGAGGGAAGCTGG - Intronic
1180948459 22:19709539-19709561 GCTGAGGGTCTGAGGGAGGTGGG - Intergenic
1181363693 22:22357799-22357821 GGTGAGGAGGAGAGGGAAGCCGG - Intergenic
1181366507 22:22380884-22380906 GGTGAGGAGGAGAGGGAAGCTGG - Intergenic
1181368633 22:22399040-22399062 GCTGCAGGCCAGTGGGTAGCTGG + Intergenic
1181501280 22:23316994-23317016 GCAGCTGCCCAGAGGGAAGCAGG + Exonic
1181581481 22:23831334-23831356 TCTGAGGGACAGAGGGAGCCAGG - Intronic
1181650872 22:24258424-24258446 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1181706509 22:24652315-24652337 GCAGCTGCCCAGAGGGAAGCAGG + Intergenic
1181854536 22:25772536-25772558 GCTGAGGGGCTGAGGGCAGGGGG + Intronic
1181976141 22:26731598-26731620 GCAGAAGGCGAAAGGGAAGCAGG + Intergenic
1182148685 22:28013559-28013581 GCTGAGGGCAAGAGGGAGGTGGG + Intronic
1182755142 22:32673228-32673250 GCTGTGGGGAAGAGGGAAGAGGG + Intronic
1183050082 22:35253801-35253823 ACTCAGAGCCAGAGAGAAGCAGG - Intergenic
1183322699 22:37174852-37174874 CCTGTGGCCCTGAGGGAAGCTGG + Intronic
1183404277 22:37622805-37622827 GCGGAGGGGCAGGGGAAAGCCGG + Intronic
1183414740 22:37675757-37675779 ACTGATGGCCAGAGGAGAGCTGG + Intronic
1183929225 22:41226616-41226638 GCAGAGGGAGAGGGGGAAGCAGG - Intronic
1183985010 22:41564766-41564788 GGTGAGGTCCAGAGAGGAGCAGG + Intronic
1184103486 22:42353974-42353996 GCTGAGGCCCTTAGGGAGGCTGG - Intergenic
1184124153 22:42475238-42475260 GGTGAGGCTCAGAGGGAGGCTGG - Intergenic
1184409508 22:44318423-44318445 GCAGAATGCCAGGGGGAAGCGGG + Intergenic
1184696375 22:46141406-46141428 GCTGAGGGGCAGAGGCAGGGAGG + Intergenic
1185266204 22:49905612-49905634 GCGGAAGGCGAGAGGGAAGCGGG - Intronic
950362509 3:12459628-12459650 ACTGAGGGCCAGAGAGGAGAAGG - Intergenic
950735022 3:15000167-15000189 GCTGAGGGGCAGGGGGAATGGGG - Intronic
951464565 3:22988320-22988342 GCTGGGGGCCAGGAGGAAGGTGG + Intergenic
951678338 3:25267375-25267397 GCGGAAGGCCAGAGTGGAGCTGG - Intronic
951897454 3:27623742-27623764 GCTGAGAGGCAGAGGGACACTGG - Intergenic
952332455 3:32376764-32376786 GCTGAGCTCCAGAGGGAAGACGG - Intergenic
952730239 3:36630900-36630922 GCTGAAGTCCAGAGAGAAGATGG - Intergenic
953184656 3:40626634-40626656 GATGAGGGACTGAGGGAAGGAGG + Intergenic
953334062 3:42078955-42078977 GCTGACGGCCAGCAGGAAACAGG + Intronic
953405920 3:42659624-42659646 GCTGGGGGCCAAGGTGAAGCTGG + Exonic
953408696 3:42675196-42675218 GCTGTGGGCAAGAGGGAGGAGGG - Intergenic
953611648 3:44451788-44451810 GCTGAGGGGTAGTGGGAAGGTGG - Intronic
953851716 3:46469995-46470017 GGAGAGGGCCAGAGGGCAGAGGG - Intronic
954214548 3:49117122-49117144 GCAGAGGGCCAGAGGGGGACGGG - Exonic
954625502 3:52019978-52020000 GTGGAGGGGCAGAGAGAAGCGGG + Intergenic
955355188 3:58225199-58225221 GCTGAGGTCAAGTGGGGAGCTGG - Intergenic
956142342 3:66158738-66158760 GTAGAGGGGCAGAGGGAAGAAGG + Intronic
956494994 3:69815402-69815424 GCTGAGGGGGAGAAGGAAGAGGG - Intronic
956762918 3:72459445-72459467 GCTGTGGGCCAGAGAGGAGGGGG + Intergenic
957018809 3:75100964-75100986 GCGGAAGGCAAAAGGGAAGCAGG - Intergenic
958856318 3:99390509-99390531 TCTGAAGACCAGAAGGAAGCAGG - Intergenic
959355604 3:105324188-105324210 GCAGAAGGCAAAAGGGAAGCAGG + Intergenic
959525194 3:107368649-107368671 GCTGAGGGCAAAGGGGAAGCGGG + Intergenic
959661757 3:108876343-108876365 TATTAGGGCCAGAGGGAAGGGGG + Intergenic
960054654 3:113268474-113268496 GCTGAGGCCAGAAGGGAAGCTGG + Intronic
961183638 3:124895896-124895918 ACTGAGGTCCAGAGGGTGGCAGG - Intronic
961390131 3:126547655-126547677 GGTGTGGACCAGAGGGAACCTGG + Intronic
961556229 3:127698209-127698231 GGTGAGGGGCAGAGGGAAACTGG + Intronic
961649299 3:128409554-128409576 GCTGAGAGCCATGGGGAAGTGGG + Intergenic
961697117 3:128713001-128713023 GCAGAAGGCCAGGGGGGAGCAGG + Intergenic
962583784 3:136820409-136820431 GCTGGTGGCCAGAGTGGAGCAGG + Intronic
963008143 3:140745538-140745560 CCTGAGGGATAGAGAGAAGCTGG + Intergenic
963069351 3:141290178-141290200 GCTGAGTGTGAGAGGGTAGCAGG + Intronic
963294213 3:143527750-143527772 GCTGAGGCACTGAGGGAAGAAGG - Intronic
964324879 3:155534866-155534888 GCAGAGGGCAAAAAGGAAGCAGG - Intronic
966287902 3:178319312-178319334 GCTAAGGGACAGAGTGAAGAGGG + Intergenic
966491065 3:180529344-180529366 GCTGAAGGCAAAGGGGAAGCAGG + Intergenic
967151122 3:186652083-186652105 GATAAGGGCCAGGGGGAACCAGG - Intronic
967316373 3:188154638-188154660 GCTGAGGCCCAGAGAGAAGGAGG + Intronic
968282106 3:197484946-197484968 GCTGAGGGCCAGAGAGCAGAGGG - Intergenic
968335879 3:197913150-197913172 GCAGATGGGAAGAGGGAAGCAGG - Intronic
968459914 4:719655-719677 GCTGAGGGCTACAGTGGAGCTGG + Intronic
968903551 4:3441965-3441987 CCTGAGGGGCAGTGGGAGGCGGG - Exonic
968951911 4:3699817-3699839 ACTGAGGGGCAGAGGCAAGAGGG + Intergenic
968958664 4:3731630-3731652 GGTGAAGTCCAGAGGCAAGCTGG + Intergenic
968979396 4:3838582-3838604 AGTGAGGGACAGAGGGAAGAGGG + Intergenic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
969167593 4:5330117-5330139 ACTGAGGCCCAGAGGGAAGAAGG - Intronic
969414705 4:7050789-7050811 GATGAGAGGCAGAGCGAAGCCGG - Intronic
969429884 4:7147891-7147913 GCTCAGGCCCAGAGGCAAGAGGG - Intergenic
969482032 4:7451792-7451814 AGTGAGGGCCAGACTGAAGCGGG + Intronic
969564745 4:7971183-7971205 ACTCAGGGCCAGAGGCAGGCAGG + Intronic
969567351 4:7986352-7986374 ACCGAGGCCCCGAGGGAAGCTGG + Intronic
973279152 4:48341473-48341495 GCGGAGGGACGGAGGGAAGATGG + Exonic
973843018 4:54881540-54881562 GCGGAGGCTCAGAGGTAAGCTGG + Intergenic
974237521 4:59200817-59200839 GCTGAGAGCCACTGGGAAGGTGG + Intergenic
975170748 4:71229543-71229565 GCCCAGGGCCAGAGGGAAATAGG - Intronic
975689515 4:76949996-76950018 GGTGAGGACCACAGGGGAGCCGG + Intronic
976000616 4:80370102-80370124 GCAGAGGGTGAAAGGGAAGCTGG + Intronic
976327035 4:83783444-83783466 GCAGAGGGCCAAAGGGGAGTAGG + Intergenic
977290299 4:95158857-95158879 ACTGAGGGAGTGAGGGAAGCTGG - Intergenic
977677585 4:99764969-99764991 GCTGAAGGCAAAGGGGAAGCAGG - Intergenic
978130724 4:105193290-105193312 GCAGAGGGCAAGTGGGAAGCAGG + Intronic
978385665 4:108173227-108173249 GCGGAGGGCCGGTGGGAAGGAGG - Intergenic
978667344 4:111200068-111200090 GCGGAAGGCAAGGGGGAAGCCGG - Intergenic
979107342 4:116705268-116705290 TCTGAGGGACAGGGGGAAGGCGG - Intergenic
979122855 4:116926042-116926064 GCCGAGGACCAGGGGGAAGGAGG - Intergenic
979428159 4:120593680-120593702 GCGGAAGGCTAAAGGGAAGCTGG + Intergenic
980999803 4:139817813-139817835 GCAGAGAGCCAGAGGAAAGTGGG - Intronic
981217086 4:142182774-142182796 GCTGAGGGCTTGAGGGAGCCTGG - Intronic
981659538 4:147149237-147149259 GCAGAGGGGCAGAGGGAAGTTGG - Intergenic
982791728 4:159600011-159600033 GCTGAGGGGCAGAGGTAAGAAGG - Intergenic
982795804 4:159642198-159642220 GCAGAAGGCCAAGGGGAAGCTGG + Intergenic
984571717 4:181403443-181403465 GCAGAAGGCAAGGGGGAAGCAGG + Intergenic
984849785 4:184143677-184143699 GCAGAGGGGCAGAGGGCAGCAGG - Intronic
985200444 4:187479140-187479162 TCTGAGAGCCACAGGGAAGCTGG - Intergenic
1202762586 4_GL000008v2_random:125159-125181 ACTGAGGGTCAGAAAGAAGCCGG + Intergenic
985471291 5:48499-48521 GCTGAGGGACAGAGTGAAGGAGG + Intergenic
985757100 5:1725604-1725626 GCTGAGGGCAAGGGGGAAGCCGG - Intergenic
986086620 5:4458680-4458702 GCAGAAGGTCAGGGGGAAGCAGG + Intergenic
986726226 5:10599485-10599507 GCTGAGGGGAAGAGGGTAGGAGG - Intronic
986890813 5:12302897-12302919 GCAGAGGGTAAAAGGGAAGCTGG + Intergenic
986988202 5:13522630-13522652 ACTGAGGCCCAGAGGGAGCCAGG - Intergenic
987064987 5:14281267-14281289 GCAGAAGGCAAGGGGGAAGCAGG + Intronic
987348981 5:17004522-17004544 GAAGAGGGCAAGAGGAAAGCCGG - Intergenic
987910466 5:24137225-24137247 GCAGAGGGAAAGAGGGAAGAGGG - Intronic
987952586 5:24694575-24694597 GCTGAAGGCAAAGGGGAAGCAGG + Intergenic
988202356 5:28083903-28083925 GCCATGGGCCAGAGTGAAGCAGG + Intergenic
988629672 5:32915304-32915326 GCTGAGGGGCAGAAGGTAGATGG - Intergenic
988672890 5:33400956-33400978 GCAGAAGGCAAGAGGGAAGCAGG - Intergenic
988876955 5:35457362-35457384 GCAGAGTGCAAGAGGGAAGAAGG + Intergenic
988961858 5:36378733-36378755 GCTGGGAGCCAGAGGGCTGCAGG - Intergenic
988988235 5:36642712-36642734 GCTGAGGGCTTGGGGGAATCGGG - Intronic
990632544 5:57686434-57686456 GGTGTGGGGCAGAGGGTAGCAGG - Intergenic
991479224 5:67059137-67059159 GCTGATAGCCAGGGTGAAGCGGG - Intronic
992143360 5:73820937-73820959 GCAGAGTCCCAGATGGAAGCAGG + Intronic
993032240 5:82718030-82718052 GCAGAAGGCAAGGGGGAAGCTGG - Intergenic
993344822 5:86769803-86769825 GCAGAAGGCAAAAGGGAAGCAGG + Intergenic
996035033 5:118749444-118749466 GGAGAGGGCCAGAAAGAAGCAGG + Intergenic
996391491 5:122967429-122967451 GATGAGCGCCTGTGGGAAGCTGG + Intronic
996443076 5:123512799-123512821 GCGGAGGGCTAGGGGGCAGCGGG + Intronic
996581599 5:125037661-125037683 GGTGAGGCCCAGAGGAAACCAGG - Intergenic
996631043 5:125632879-125632901 ACTGGGGGCGAGAGGGAGGCTGG + Intergenic
997695454 5:135857641-135857663 GCTGAGAGCCAGAGAGGAACTGG + Intronic
998147811 5:139740226-139740248 GCTAAGGCTCAGAGTGAAGCAGG - Intergenic
998154443 5:139776403-139776425 CCTGAGGCCCAGAGAGGAGCAGG + Intergenic
998182507 5:139955353-139955375 GCAGAGGCCCAGAGGGGAGAGGG + Intronic
998458079 5:142289208-142289230 ACTGAGGGCCAGAGTAAAGCTGG - Intergenic
998819398 5:146044653-146044675 GCAGAGGGACAGAGGGAGGAAGG - Intronic
999446849 5:151646911-151646933 TCTGAGGGACAGATGGAAGTAGG + Intergenic
999454336 5:151702546-151702568 GCTGAGCGGCTGAGGGAAGCTGG - Intergenic
999519365 5:152334799-152334821 GCTGAGGCCCAGAGAAAAGAAGG - Intergenic
1000345535 5:160311122-160311144 GCTGAGGGGCATTGGGAAGGTGG - Intronic
1000627815 5:163559330-163559352 GCCTAGGGCCAGAGGGTAGGTGG - Intergenic
1000822955 5:166007993-166008015 GCTGGAGGGCAGAGGGAAGAGGG - Intergenic
1001009774 5:168086980-168087002 ACTGGGGGCCAGTGAGAAGCTGG - Intronic
1001489956 5:172148303-172148325 GGTGGGGGGCAGAGGGAAGCAGG + Intronic
1001634006 5:173196904-173196926 GCTGAGACCCACAGGGAAGTGGG + Intergenic
1001876535 5:175206543-175206565 GGTGAGGTCCACAGGAAAGCAGG - Intergenic
1002019473 5:176353733-176353755 GCTGAGGCCCAGAAGAAATCTGG + Intronic
1002199736 5:177521007-177521029 GCTTAGGCCCAGAGAGGAGCTGG + Intronic
1002575678 5:180172457-180172479 GCTGAGGGGCAGAGGGACAGGGG + Intronic
1002596796 5:180328960-180328982 GCTGAGGCCCAGAGGGCAGGTGG - Intronic
1002807580 6:591845-591867 GTGGAGGCCCTGAGGGAAGCTGG - Intronic
1003011775 6:2433665-2433687 GCTGAGATACAGAGGGCAGCGGG - Intergenic
1003427876 6:6009232-6009254 GCTGAGGGCCTCAATGAAGCGGG + Intergenic
1003613152 6:7631081-7631103 GCAGAAGGTCAGAGAGAAGCTGG + Intergenic
1003775171 6:9352318-9352340 GCAGAAGGCAATAGGGAAGCAGG - Intergenic
1003856257 6:10279324-10279346 GCAGAAGGCAAAAGGGAAGCAGG + Intergenic
1003974101 6:11326656-11326678 CAGGAGGGGCAGAGGGAAGCTGG - Intronic
1004700706 6:18076935-18076957 GCAGAGGGCAAAAGGGGAGCTGG + Intergenic
1004878717 6:19984013-19984035 GATGGGGGCCAGTGAGAAGCAGG - Intergenic
1005549686 6:26899674-26899696 ACTGAGGGCCAGCTGGCAGCGGG - Intergenic
1006132524 6:31877977-31877999 CCTTAGGGCCATAGGGGAGCAGG - Intronic
1006178981 6:32142403-32142425 ACATAGGGCGAGAGGGAAGCAGG + Intergenic
1006297507 6:33176468-33176490 CCTGAGGTCCAGAGGGACCCTGG + Exonic
1006338261 6:33432044-33432066 GCTGAGGGGCAGAGGGAGGTGGG + Intronic
1006371926 6:33650150-33650172 GCTGAAGGGCAGAGAGAAGGAGG - Intronic
1006378967 6:33686982-33687004 GTGGAGGGGCAGAGGGAGGCAGG - Intronic
1006435066 6:34021765-34021787 GCTTAGACCTAGAGGGAAGCGGG - Intronic
1006837302 6:37006788-37006810 GCTGTGGGTGTGAGGGAAGCAGG + Intronic
1006929763 6:37680720-37680742 GCTGAGGCCCAGAGGGGAGTTGG - Intronic
1007391656 6:41552927-41552949 ACTGAGGCCCAGAGAGAAGACGG - Intronic
1007401151 6:41603158-41603180 GCTGAGTGCCAAGGGGAAGGGGG - Intergenic
1007415576 6:41689426-41689448 GCGAAGGGGCAGAGGGAGGCAGG - Intronic
1007494319 6:42249141-42249163 GCTGAGGGCCACACGGATTCTGG - Intronic
1007535009 6:42579203-42579225 GCTGAAGGGGAAAGGGAAGCAGG + Intronic
1007718322 6:43870104-43870126 TCTGAGGGCCAGTGGGCACCAGG - Intergenic
1007753044 6:44081583-44081605 GCTGCGGGGCAGAGGGATTCTGG - Intergenic
1007989959 6:46244722-46244744 ACTAAGGCCCAGAGCGAAGCAGG - Intronic
1008076475 6:47151362-47151384 GGTTAGGGCCAGGGGGAAGAAGG - Intergenic
1009913515 6:69963555-69963577 GCTGAGGGCTAGAGGATAGTGGG - Intronic
1010189111 6:73176360-73176382 GCGGACGGCAAAAGGGAAGCAGG - Intronic
1012813774 6:103995552-103995574 GCTTAGGGACAGAGGGTAGAGGG - Intergenic
1012981065 6:105831052-105831074 GATGAGGGGAAGGGGGAAGCTGG + Intergenic
1013074657 6:106760754-106760776 GTTGAAGGTAAGAGGGAAGCTGG + Intergenic
1013190675 6:107802471-107802493 GCAGAGTGACAGAGGGAAGGCGG + Intronic
1014127607 6:117794795-117794817 GCAGTGGGCCAAAGGGAAGCTGG + Intergenic
1014787071 6:125631341-125631363 GCTTGGGGCCAGTGGGAGGCAGG - Intergenic
1015266442 6:131295982-131296004 GTTGAGGGACAGAGAGAGGCTGG - Intergenic
1015267565 6:131303866-131303888 GCTGAAGGCAACGGGGAAGCAGG - Intergenic
1015270845 6:131337280-131337302 GCAGAGGGCAAGTGGGAATCAGG + Intergenic
1015633293 6:135252376-135252398 GATGAGGCACAGAGGGAGGCCGG - Intergenic
1016340833 6:143060514-143060536 GCTGATCTCCAGGGGGAAGCGGG - Intronic
1017134884 6:151139644-151139666 GCTGAGGCCCTGTGCGAAGCTGG + Intergenic
1017561804 6:155636293-155636315 TCAGAGTGCCAGAGGGAGGCAGG + Intergenic
1018154109 6:160969618-160969640 GCTGAGGGACATAGGGAAAGAGG - Intergenic
1018513864 6:164556556-164556578 TGTGAGGACCAGAGGGAAGGCGG - Intergenic
1018635786 6:165858271-165858293 GCTGAGGGCCTGAGGAAAGCTGG - Intronic
1018692390 6:166358007-166358029 GCAGAAGGCAAAAGGGAAGCAGG + Intergenic
1018870018 6:167775581-167775603 GTTGAGGGGCAGAGGGTAGGTGG - Intergenic
1018987529 6:168649113-168649135 TCTGAGGGCCACGGGGAAGGCGG + Intronic
1019282501 7:207552-207574 GCAAAGGGGAAGAGGGAAGCGGG - Intronic
1019305945 7:335809-335831 GTGGAGGGCAAGAGGGAAGGTGG + Intergenic
1019315076 7:380548-380570 GCAGGGGGACAGAGGGAGGCAGG + Intergenic
1019726023 7:2603146-2603168 GATGAGGGCCTGAGGGCTGCTGG - Intronic
1019738656 7:2662357-2662379 GCTGAGGGAGAGAGTGAAGCTGG - Exonic
1019755030 7:2762700-2762722 GAGGAGCGCCAGAGGGAAGCAGG + Intronic
1019998934 7:4743752-4743774 CCTCAGGTCCAGAGAGAAGCAGG + Intronic
1020617445 7:10476936-10476958 GATGAAGGCCAGGGAGAAGCGGG - Intergenic
1021292791 7:18866475-18866497 ACTGAGGGACAGAGGAGAGCGGG - Intronic
1021609748 7:22445539-22445561 GCTGAGGGGCGGAGGCCAGCGGG + Intronic
1022247602 7:28575603-28575625 GCTGAGGACCAGTGACAAGCCGG - Intronic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1022536628 7:31102488-31102510 GCCTAGGGCCAGAGGCAGGCAGG + Intronic
1022813398 7:33890864-33890886 GGAGAGGAGCAGAGGGAAGCAGG + Intergenic
1023119517 7:36895097-36895119 GCAGAGGGCACCAGGGAAGCAGG - Intronic
1023327471 7:39075645-39075667 CCTGAAGGCCACAGGGAGGCTGG + Intronic
1023383868 7:39635498-39635520 GCTGAGGGGCAGAAGAAATCAGG - Intronic
1023837568 7:44077305-44077327 GCAGAGGGGCAGAGGGGAGGAGG + Intronic
1023965536 7:44961626-44961648 GCTGAGGGCCTGAGGGACTGAGG + Intergenic
1025256675 7:57388660-57388682 GCAGGAGGCCAGAGGGGAGCAGG - Intergenic
1026091204 7:67302367-67302389 GCTGAGAGCTAGAGGTGAGCTGG - Intergenic
1026546725 7:71329604-71329626 GCAGAAGGCGAAAGGGAAGCAGG + Intronic
1029867345 7:103648328-103648350 GCAGAAGGCCAAAGGGAAGCAGG - Intronic
1030062641 7:105635164-105635186 GCTGAGAGCCCGCAGGAAGCTGG - Intronic
1030429509 7:109425701-109425723 GCTGGGGGTCCGAGGGGAGCTGG - Intergenic
1032087888 7:128893247-128893269 GCTGGCGGCCAGAGGCAGGCAGG + Exonic
1032127486 7:129205461-129205483 GAAGAGAGCCAGAGGGAAGGGGG + Intronic
1032399226 7:131611978-131612000 GCTGGGGGCCAGAGGAAACTCGG - Intergenic
1032475419 7:132208481-132208503 CCAGAGGGCCAGAGCGCAGCAGG + Intronic
1032795761 7:135275105-135275127 GCTGTGTGCCAGAGGCATGCAGG + Intergenic
1032845162 7:135745777-135745799 GCTGGGGGCCAAAGGGCAGGGGG + Intronic
1034420859 7:150989905-150989927 GCTGAGGGTCACAGGGAGGATGG - Intergenic
1035428219 7:158796726-158796748 AGTGCGGGCGAGAGGGAAGCAGG + Intronic
1035535873 8:391072-391094 GCTGAGGGCCACTGGGAAGGAGG - Intergenic
1035587133 8:785458-785480 GCTGAGGGGAGGAGGGAGGCCGG - Intergenic
1035587144 8:785491-785513 CCTGAGGGGAGGAGGGAAGCTGG - Intergenic
1035587154 8:785525-785547 CCTGAGGGGAGGAGGGAAGCCGG - Intergenic
1035587213 8:785692-785714 CCTGAGGGGAGGAGGGAAGCCGG - Intergenic
1035722678 8:1803700-1803722 GCGGAAGGCAAGAGGGAAGCAGG - Intergenic
1037337108 8:17801762-17801784 GCAGGTGGCCAGAGGCAAGCAGG - Intergenic
1037372703 8:18197039-18197061 GCGGAAGGCAAAAGGGAAGCAGG + Intronic
1037584131 8:20264872-20264894 GCTGAGGGGAAGAGGGAAACGGG + Intronic
1037601621 8:20401072-20401094 GCAGAGGGCCTGAGAGAAGAGGG + Intergenic
1038292268 8:26260501-26260523 TCTCAGGACCAGAGGGATGCAGG - Intergenic
1038292460 8:26262146-26262168 TCTCAGCGCCAGAGGGATGCAGG + Intergenic
1038426655 8:27468324-27468346 GCTGAGGGCCAGAGGGAAGCAGG - Intronic
1038676944 8:29631464-29631486 GCTGAGAGGCCGAGGGAGGCAGG + Intergenic
1039567602 8:38562585-38562607 GCTGAAGGACAGAGAGAAACTGG + Intergenic
1040077160 8:43247453-43247475 GCTGCGGGGCTGCGGGAAGCCGG - Intergenic
1040738495 8:50541399-50541421 GAGGAGGGCAAGAGGGATGCTGG - Intronic
1040834826 8:51720813-51720835 GCACAGGGCCAGTGGGGAGCTGG - Intronic
1040947862 8:52903113-52903135 GCTTAGAGCCTGAGGGATGCTGG + Intergenic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1043012732 8:74900834-74900856 CCTGAGGGCCAAAGGGACCCTGG + Intergenic
1044233679 8:89806848-89806870 GCTGAGGTCCAGAGGACAGCTGG - Intergenic
1044600623 8:94000302-94000324 GTTGAGTGCCAGAGGGTAGAGGG - Intergenic
1044632010 8:94289311-94289333 GGTGAGGGCCAGGGGGACACAGG + Intergenic
1045482251 8:102601596-102601618 GCTGAGGGCCTGGGGCAGGCTGG - Intergenic
1046369076 8:113276494-113276516 GCTGACAGCCAGAAGGAAACAGG + Intronic
1047476302 8:125234787-125234809 GAAGAGGGCCATAAGGAAGCTGG - Intronic
1047700958 8:127448972-127448994 GCTGAGTGGGAGGGGGAAGCCGG - Intergenic
1047812823 8:128428976-128428998 TTTCAGTGCCAGAGGGAAGCAGG + Intergenic
1047906045 8:129474312-129474334 GCTGAAGTCCAGAGGGGAGTGGG - Intergenic
1048882240 8:138880814-138880836 GCTGAGGGCCAGGCAGAACCCGG + Intronic
1049006602 8:139859647-139859669 CCAGACGGCCAGAGAGAAGCTGG + Intronic
1049154232 8:141057096-141057118 GCTGTGGGGCAGAGAGAAGGGGG - Intergenic
1049216026 8:141408804-141408826 GCTGGGGAACAGAGGGATGCTGG + Intronic
1049354320 8:142180065-142180087 GCTGTGGGCCAGAAGGAGCCGGG + Intergenic
1049378026 8:142298291-142298313 ACAGAGTGCCAGAGGGAACCCGG + Intronic
1049407664 8:142458841-142458863 GCTGAGGGGCAGTGGGTAACGGG + Intronic
1049439994 8:142605002-142605024 GTTGAGGGTCAGAGAGAAGGTGG - Intergenic
1049572796 8:143377558-143377580 ACTGAGGCCCAGAGGGAGGGAGG + Intronic
1051528575 9:18075027-18075049 AGGGAGGGCAAGAGGGAAGCAGG - Intergenic
1051666333 9:19470133-19470155 GCCCAGGCCTAGAGGGAAGCAGG - Intergenic
1052999678 9:34571080-34571102 GCTGAGGGTCAGAAGGAGCCAGG - Intronic
1053025253 9:34723983-34724005 GCTGAAGACCAGAGGCCAGCAGG - Exonic
1053036782 9:34833045-34833067 GCTGAAGACCAGAGGCCAGCAGG - Intergenic
1053382026 9:37656720-37656742 CCTGAAGGACAGTGGGAAGCCGG + Intronic
1053391549 9:37739957-37739979 ACTGAGGGCCAGAGGGTGGCTGG - Intronic
1053476610 9:38386450-38386472 ACTGAGGCCCAGAGGGAGGTAGG + Intergenic
1053753706 9:41280869-41280891 GATGAAGGCCAGGGAGAAGCAGG - Intergenic
1053885666 9:42643812-42643834 GAAGAGGGCGAGCGGGAAGCGGG - Intergenic
1054224685 9:62451261-62451283 GAAGAGGGCGAGCGGGAAGCAGG - Intergenic
1054259229 9:62845229-62845251 GATGAAGGCCAGGGAGAAGCAGG - Intergenic
1054332550 9:63774808-63774830 GATGAAGGCCAGGGAGAAGCAGG + Intergenic
1054744707 9:68843018-68843040 CGTGAAGGGCAGAGGGAAGCTGG - Intronic
1055156811 9:73072841-73072863 GCTGAAGGTGAAAGGGAAGCTGG - Intronic
1055264650 9:74481040-74481062 TGTGAAGGCCAGAGGTAAGCAGG - Intergenic
1055934347 9:81590885-81590907 GCTGATGGCCAGGGCGTAGCAGG + Exonic
1056628837 9:88276043-88276065 GCAGAGGGGAAGAGGGAAGGGGG - Intergenic
1057214186 9:93219040-93219062 GCTGAGGGGCAGAGGGACACAGG - Intronic
1057421884 9:94919430-94919452 TCTCAGGGCCAGAGGGAAGGAGG + Intronic
1057557909 9:96102285-96102307 ACAGAAGGCCAGGGGGAAGCAGG + Intergenic
1057678163 9:97152470-97152492 GCTCAGGGTCAGAAAGAAGCTGG + Intergenic
1057919281 9:99083214-99083236 GCTGAGGGGCAGAAGGGCGCTGG + Intergenic
1058953603 9:109925820-109925842 GCTGAGGGCCAAATGAAAGTAGG - Intronic
1059448160 9:114352076-114352098 GCTGGGGGCAGGAGGGAAGTGGG + Intronic
1059584838 9:115594989-115595011 GTTGGGGGTCAGAGGGAAGAGGG - Intergenic
1059655244 9:116352049-116352071 GCTGACTGCCATTGGGAAGCTGG - Intronic
1060011950 9:120051564-120051586 GCTGAGGAGGAAAGGGAAGCTGG - Intergenic
1060189374 9:121582362-121582384 GCTGAGTCTCAGAGGGAACCAGG + Intronic
1060207864 9:121693209-121693231 TCTGAGGCCCAGAGGGCAGTGGG - Intronic
1060399278 9:123338744-123338766 GTTGAGGCCCTGAGAGAAGCAGG + Intergenic
1060468678 9:123929975-123929997 GGAGAGCGCCAGAGGGAGGCCGG - Exonic
1060754945 9:126205926-126205948 GCTGAGTCCCACAGAGAAGCTGG + Intergenic
1060768329 9:126311656-126311678 GCAGAAGGCAAAAGGGAAGCAGG + Intergenic
1060977070 9:127771142-127771164 GGGGAGGGCCAGCGGGGAGCAGG - Intronic
1061191073 9:129083100-129083122 GCAGAGGTTGAGAGGGAAGCAGG + Intronic
1061399851 9:130362278-130362300 GCCGAGGGCTAGAGGGAGGTGGG + Intronic
1061778992 9:132984812-132984834 GCTCTGGGCCAGGGGGAAGCAGG + Intronic
1062150100 9:135013781-135013803 TCTAAGGGCCAGAGGGAAACAGG - Intergenic
1062207073 9:135343103-135343125 GCTGAGAGGCAGGAGGAAGCTGG - Intergenic
1062282620 9:135758821-135758843 GCTGAGGCCCAGCTGAAAGCAGG + Intronic
1062324895 9:136008075-136008097 GCTGTGGGCAAGAGGTCAGCAGG - Exonic
1062363641 9:136198872-136198894 GCCGCGGGCGGGAGGGAAGCAGG + Intronic
1062398449 9:136362143-136362165 CCTGACGGCCAGAGGCGAGCAGG - Exonic
1062517963 9:136945530-136945552 GTTGCGGGGGAGAGGGAAGCAGG + Intronic
1062544641 9:137055962-137055984 GGAGAGCGTCAGAGGGAAGCTGG + Intergenic
1062571975 9:137189932-137189954 GCTGAGGGGCACACGGAGGCAGG - Exonic
1062697875 9:137884685-137884707 GGTGCGGGCCAGCGGGCAGCTGG + Intronic
1202799557 9_KI270719v1_random:163119-163141 GATGAAGGCCAGGGAGAAGCAGG + Intergenic
1203543346 Un_KI270743v1:110040-110062 ACTGAGGGTCAGAAAGAAGCCGG + Intergenic
1186032532 X:5385503-5385525 CCCCAGGGCCAGAGGGGAGCAGG + Intergenic
1186453130 X:9689756-9689778 GGTGATGGCAAGAGGGAAACTGG - Intronic
1186461107 X:9749282-9749304 GCAGAAGGCCAAGGGGAAGCAGG - Intronic
1187274423 X:17805605-17805627 GCTGAGGCCCAGTGGGATGAAGG + Intronic
1187440840 X:19318461-19318483 GATGAGGCCCTGAGGGAAGGGGG + Intergenic
1188897108 X:35682742-35682764 GCTCAGGGTCAGATGGAGGCTGG - Intergenic
1189220111 X:39364314-39364336 GCAGAAGGCAAAAGGGAAGCAGG - Intergenic
1189405537 X:40719632-40719654 GCTTAGGGCTAGAGGAGAGCTGG + Intronic
1189548642 X:42070490-42070512 CCTGTGGGGCAGAGGGGAGCAGG + Intergenic
1190101089 X:47523688-47523710 GCGGAGGGCCAGGGGGAGGCAGG - Intergenic
1190122746 X:47676063-47676085 GCTCAGGCACAGAGGGAGGCGGG + Intergenic
1190810477 X:53878698-53878720 GCCAAGAGCCAGAGAGAAGCTGG + Intergenic
1191027574 X:55930962-55930984 CCTGAGGTACAGAGAGAAGCTGG - Intergenic
1193175707 X:78389700-78389722 GCAGAAGGCAAAAGGGAAGCAGG + Intergenic
1193473545 X:81935366-81935388 GGTGAAGGGCAAAGGGAAGCTGG - Intergenic
1193693926 X:84682506-84682528 GCTGGGGGCCAGAAGGAAAAGGG + Intergenic
1195711514 X:107776659-107776681 GCGAAGGGGCAGAGGGAAACCGG - Intronic
1195920095 X:109975050-109975072 TCTGAGATCCAGAGAGAAGCTGG - Intergenic
1196864705 X:120060341-120060363 GCTGGGAGCCAGAGGGGAGAGGG - Intergenic
1196878396 X:120175990-120176012 GCTGGGAGCCAGAGGGGAGAGGG + Intergenic
1197823784 X:130567525-130567547 GCAGAAGGCGAAAGGGAAGCAGG - Intergenic
1198028411 X:132731370-132731392 CCTGAGGGCCAGAGTGGAGATGG + Intronic
1198479368 X:137027007-137027029 GCTGATGGCAAGAGGTAGGCAGG + Intergenic
1198836416 X:140809625-140809647 GCAGAAGGCAAAAGGGAAGCAGG + Intergenic
1198964066 X:142208727-142208749 GCTGACAGCAGGAGGGAAGCTGG + Intergenic
1199062589 X:143376442-143376464 GCCCAGTGCCAGAGGGAAGCTGG + Intergenic
1199544978 X:148998888-148998910 GGTGATGGACAGAGGGAAGGAGG - Exonic
1199676880 X:150196584-150196606 GCTGAGAGCCTGAGGGGAGGAGG - Intergenic
1199700953 X:150375175-150375197 ACTGAGGCCCAGAGAGGAGCAGG + Intronic
1199719542 X:150532632-150532654 GCAGAGGCCTAGAGAGAAGCTGG + Intergenic
1199757678 X:150880530-150880552 GCTGAGGGCCAGGGGGAAGGTGG + Intronic
1200145023 X:153921945-153921967 GCTGAGGGCAAGAGCTAAGAGGG + Intronic
1200163039 X:154019003-154019025 GGTGGAGGCCACAGGGAAGCAGG + Exonic
1201683122 Y:16670837-16670859 GCCAAGGACCAGAGGGAATCTGG + Intergenic