ID: 1038427297

View in Genome Browser
Species Human (GRCh38)
Location 8:27472090-27472112
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038427290_1038427297 30 Left 1038427290 8:27472037-27472059 CCGAAAGGACAGGTTTTGAAGAG 0: 1
1: 5
2: 24
3: 97
4: 415
Right 1038427297 8:27472090-27472112 GAGGGGTGATGAGCCCAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr