ID: 1038428356

View in Genome Browser
Species Human (GRCh38)
Location 8:27479916-27479938
Sequence GCTGAAGGGAAGGAACGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038428356_1038428367 22 Left 1038428356 8:27479916-27479938 CCCACTCGTTCCTTCCCTTCAGC No data
Right 1038428367 8:27479961-27479983 CCCTAAAAACACTCTGCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038428356 Original CRISPR GCTGAAGGGAAGGAACGAGT GGG (reversed) Intergenic
No off target data available for this crispr