ID: 1038431617

View in Genome Browser
Species Human (GRCh38)
Location 8:27504888-27504910
Sequence GGGGGTATCTGGAGCATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038431607_1038431617 5 Left 1038431607 8:27504860-27504882 CCTGCTTGGCCCATCATTGGAGT 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1038431617 8:27504888-27504910 GGGGGTATCTGGAGCATTTCAGG 0: 1
1: 0
2: 0
3: 15
4: 146
1038431610_1038431617 -4 Left 1038431610 8:27504869-27504891 CCCATCATTGGAGTCCCTTGGGG 0: 1
1: 0
2: 1
3: 6
4: 86
Right 1038431617 8:27504888-27504910 GGGGGTATCTGGAGCATTTCAGG 0: 1
1: 0
2: 0
3: 15
4: 146
1038431612_1038431617 -5 Left 1038431612 8:27504870-27504892 CCATCATTGGAGTCCCTTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1038431617 8:27504888-27504910 GGGGGTATCTGGAGCATTTCAGG 0: 1
1: 0
2: 0
3: 15
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038431617 Original CRISPR GGGGGTATCTGGAGCATTTC AGG Intronic
901241274 1:7695158-7695180 GGCTGTGTCTGCAGCATTTCTGG - Intronic
902958277 1:19942095-19942117 AGTGGAATCTGGACCATTTCAGG - Intergenic
904498996 1:30903287-30903309 GGGGGCATCTGGCACATATCAGG + Intronic
905290741 1:36920390-36920412 GGGGGGATCTGGAGCAGGTAAGG - Intronic
911134083 1:94420242-94420264 GGGGGCATGAGGAGAATTTCTGG - Intronic
911464960 1:98239870-98239892 GGGGGTACCAGCAGCACTTCTGG + Intergenic
916658705 1:166901189-166901211 CGGGGAATGTGGAGCATTTGAGG - Intergenic
920053670 1:203178104-203178126 GTGAGTATCTGGAGCCTTTTTGG + Intergenic
923860564 1:237888488-237888510 GTCAGTATCTGGAGCATCTCGGG + Exonic
1063021268 10:2130652-2130674 CGGGGAACCTGAAGCATTTCTGG - Intergenic
1063522225 10:6751344-6751366 TGGAGTATCTGGGGCATTGCTGG + Intergenic
1066153669 10:32651560-32651582 AGCGGTTTCTGGAGGATTTCGGG + Intronic
1066816094 10:39415478-39415500 GTGGATATTTGGAGCATTTTCGG + Intergenic
1066821740 10:39501764-39501786 GTGGGTATTTGGAGCACTTTGGG + Intergenic
1067039711 10:42942702-42942724 TGGGCTATCTGGAGCAGCTCAGG - Intergenic
1068745636 10:60527791-60527813 GTGGATATCTTAAGCATTTCAGG + Intronic
1070711570 10:78686885-78686907 GGGTGTGCCTGGAGCATTTGAGG + Intergenic
1070956801 10:80469169-80469191 GGGGGTAACTGGAGCCCTCCTGG + Intronic
1072232994 10:93428917-93428939 GGGGGTCCCTGGAGCACCTCTGG - Intronic
1075706941 10:124507378-124507400 GGGGGGATAGGGAGTATTTCAGG + Intronic
1075706964 10:124507452-124507474 GGGGGGATAGGGAGGATTTCAGG + Intronic
1075706977 10:124507501-124507523 GGGGGGATAGGGAGTATTTCAGG + Intronic
1075706999 10:124507575-124507597 GGGGGGATAGGGAGTATTTCAGG + Intronic
1075707017 10:124507649-124507671 GGGGGGATAGGGAGTATTTCAGG + Intronic
1075707052 10:124507772-124507794 GGGGGGATAGGGAGTATTTCAGG + Intronic
1076834052 10:133012133-133012155 GGAGGGATCTGGAGAATCTCAGG + Intergenic
1082723423 11:56706463-56706485 GGGTGCAGCTGTAGCATTTCTGG + Intergenic
1083274968 11:61591651-61591673 GGGGGCGTGGGGAGCATTTCAGG + Intergenic
1084700853 11:70785366-70785388 GGGGGCATCTGGAGCAATGCAGG - Intronic
1089409541 11:118228739-118228761 GGGGGCTTATGGAGTATTTCAGG - Exonic
1090909791 11:131108875-131108897 AGTGGTATCTGGAGCTTTGCAGG - Intergenic
1097195837 12:57242094-57242116 GGGGGTCTCTCGAGGATCTCGGG + Intergenic
1097223753 12:57465034-57465056 TGGGCTATTTGGAGGATTTCTGG - Intronic
1097279664 12:57837030-57837052 GAGAGTATTTGGAGCATTTCCGG + Intronic
1098154413 12:67582581-67582603 AGGGGTATCTGGGGAACTTCTGG - Intergenic
1103488026 12:121296241-121296263 GGGGAAATCTGGAGCGTTCCGGG - Intronic
1109996259 13:70131296-70131318 GGGGACATCTGTAGCATTTTAGG - Intergenic
1115880972 14:37918842-37918864 CTGGGTATGTGCAGCATTTCTGG + Intronic
1120023876 14:79560421-79560443 GGGGGTGGGAGGAGCATTTCTGG + Intronic
1123414119 15:20082675-20082697 GGGAGTATCTGGAGCAGCTCAGG + Intergenic
1123523461 15:21089786-21089808 GGGAGTATCTGGAGCAGCTCAGG + Intergenic
1123811690 15:23932819-23932841 GAGGAGATCTGGAGCATTTAAGG - Intergenic
1126098078 15:45103148-45103170 TGGGGTATCTGGACCATATGAGG + Intronic
1129757055 15:78105011-78105033 GGGGGGGTGGGGAGCATTTCTGG + Exonic
1130907033 15:88247982-88248004 TGGGGTGCCAGGAGCATTTCTGG - Intronic
1131459715 15:92609584-92609606 GAGGATATCTGGGGCATATCAGG - Intergenic
1132694979 16:1198083-1198105 GGGGGTCTCTGCAGCAGGTCTGG - Intronic
1133669053 16:7999814-7999836 GTGGGCATATGGTGCATTTCAGG - Intergenic
1133814620 16:9187141-9187163 GATGGTTTCTGGAGCATTTATGG + Intergenic
1134246775 16:12545890-12545912 TGGGGTACCTGGAGCATTCTAGG + Intronic
1134742873 16:16563648-16563670 GAGAGTATCTGGATAATTTCAGG - Intergenic
1134924687 16:18148818-18148840 GAGAGTATCTGGATAATTTCAGG + Intergenic
1138488495 16:57362126-57362148 GGGGGCCTCTTGAGCATTACAGG + Intronic
1139290656 16:65855346-65855368 GGCTGTATCTGGAGCTTGTCGGG - Intergenic
1140499431 16:75421055-75421077 GGGGGTCCCTGGAGAATCTCCGG + Intronic
1140748499 16:78002405-78002427 GGAGGTAGCTGGAGCATCTCTGG + Intergenic
1141997943 16:87647141-87647163 GGGGCTCTGTGGAGCATTGCTGG + Intronic
1143930168 17:10414277-10414299 GTGGTGATCAGGAGCATTTCTGG + Exonic
1143938499 17:10512766-10512788 GTGGTGATCAGGAGCATTTCTGG + Exonic
1149494019 17:57105741-57105763 GGGTGTGTCTGGAGCAATGCTGG - Exonic
1155480169 18:26277596-26277618 GGGAGTATTTGGAGAATATCTGG + Intronic
1155917423 18:31570176-31570198 GGGGGTTTCTGGAACATGGCAGG - Intergenic
1156030935 18:32711286-32711308 GTGGGTATATGTAGCATTTGGGG + Intronic
1158186301 18:54775749-54775771 GGGAGTTTCATGAGCATTTCAGG - Intronic
1162913189 19:13860967-13860989 GGTGGCAACTGGAGCAATTCTGG + Intergenic
1163533630 19:17864601-17864623 GGGGGAATCTGTAGTATTCCAGG - Intergenic
1164340358 19:24389202-24389224 GTGGGTATTTGGAGCCTTTCTGG + Intergenic
925109040 2:1317775-1317797 TTGGGATTCTGGAGCATTTCAGG + Intronic
925214814 2:2085279-2085301 GGGGGTCTCTAGAGGATTTGGGG - Intronic
928237715 2:29559159-29559181 GGGGCTCTCTGTACCATTTCAGG - Intronic
930842828 2:55866402-55866424 GGGGATATCTGGTTCATTTTGGG + Exonic
932452007 2:71817043-71817065 GGGGGTATCTGGAGACCATCTGG + Intergenic
933731433 2:85459243-85459265 GGAGGTACCTGGAGCCTTTTAGG - Intergenic
939114060 2:138040476-138040498 TAAGGAATCTGGAGCATTTCTGG + Intergenic
943993285 2:194725814-194725836 GGGGCTATCTTGTGCATTTTAGG - Intergenic
944242284 2:197498832-197498854 GTGGGTAACCGAAGCATTTCTGG + Exonic
945878682 2:215304769-215304791 GGGTGTGTCGTGAGCATTTCAGG - Intergenic
947270018 2:228323738-228323760 GAGGCTATCTGGAGCTTCTCCGG - Intergenic
1170890820 20:20373859-20373881 GAGGGTCTCTGGAGCCTTTGTGG + Intergenic
1171728382 20:28650418-28650440 GGGGATATTTGGAGCGTTTTGGG + Intergenic
1171728492 20:28652506-28652528 GGGGATATTTGGAGCGTTTTGGG - Intergenic
1171728610 20:28654602-28654624 GGGGATATTTGGAGCGTTTTGGG - Intergenic
1171730050 20:28681030-28681052 GGGGATATTTGGAGCGTTTTGGG + Intergenic
1171730459 20:28688667-28688689 GGGGATATTTGGAGCGTTTTGGG - Intergenic
1171730953 20:28697462-28697484 GGGGATATTTGGAGCGTTTTGGG - Intergenic
1171732113 20:28718851-28718873 GGGGATATTTGGAGCGTTTTGGG - Intergenic
1171736064 20:28786796-28786818 GTGGATATTTGGAGCATTTGAGG - Intergenic
1171824631 20:29883765-29883787 GTGGGTATCTGCATCATTGCAGG - Intergenic
1176317935 21:5267941-5267963 GGGGATATTTGGAGCGTTTTGGG - Intergenic
1176475798 21:7204716-7204738 GGGGATATTTGGAGCGTTTTGGG - Intergenic
1176869717 21:14075099-14075121 GGGGCAATCTGGAGCACTCCTGG + Intergenic
1179197841 21:39182940-39182962 GAGCGTTTCTGGAGCATTTCTGG - Intronic
1179481202 21:41679642-41679664 AGGGGTAGCTGGAGTGTTTCAGG + Intergenic
1179621419 21:42618666-42618688 GAAGGCACCTGGAGCATTTCTGG - Intergenic
1180395606 22:12332127-12332149 GGGGATATTTGGAGCGTTTTGGG - Intergenic
1180404139 22:12532624-12532646 GGGGATATTTGGAGCGTTTTGGG + Intergenic
1180609644 22:17086770-17086792 GGGGGTAGCAGGAGCATTCCAGG + Intronic
1180879945 22:19196510-19196532 TGGAGCATCTGGAGCTTTTCTGG - Exonic
1181010865 22:20039861-20039883 GGGGGTATGTGCATCATCTCGGG - Intronic
1182545998 22:31076893-31076915 GGGAGTATCTGGAGCAGCTCAGG - Intronic
1183399891 22:37596579-37596601 GGGGGTTCCAGGAGTATTTCTGG - Intergenic
1184784646 22:46665830-46665852 GGGGGTCTCTGGAGCCTGTCAGG - Intronic
950440878 3:13009528-13009550 GCGGGCATCTGGGGCATTTCCGG - Intronic
953242801 3:41164913-41164935 GGGGGTTTCTGGAGGACTGCAGG - Intergenic
953447040 3:42977233-42977255 GGGGATATCTGGGGCATTCTAGG + Intronic
953982571 3:47420053-47420075 GGGGGACTCTGGAGCAGGTCAGG - Intronic
956297378 3:67729105-67729127 GGGCATTTCTGGAGAATTTCTGG + Intergenic
964396759 3:156253928-156253950 GGGGGTATATGATGCATTTCTGG + Intronic
965291476 3:166887368-166887390 GTGGGTAATTGGTGCATTTCTGG - Intergenic
966540466 3:181084584-181084606 GAGGGCACCTAGAGCATTTCTGG - Intergenic
969580450 4:8061672-8061694 GGGGGTAAAGGGAGCATTTCGGG - Intronic
970464153 4:16306388-16306410 GGGGGTAGGAGGAGCATTTGGGG - Intergenic
973228235 4:47811093-47811115 GGAGGTATTTGCAGTATTTCAGG - Intronic
973764725 4:54152629-54152651 GGGAGCCTCTGGAGCATTTTGGG + Intronic
975150874 4:71019502-71019524 AGGGGTCTCTGGATCTTTTCAGG - Intronic
982887974 4:160807393-160807415 AGGGGCATCTGGAAGATTTCTGG + Intergenic
984850765 4:184150596-184150618 GGGGGCAGCTGCAGTATTTCTGG - Intronic
984981825 4:185289445-185289467 GGGGGTATCTGGAGAAGGGCAGG + Intronic
985369704 4:189272937-189272959 GTGGGTATCTGCATCATTGCAGG - Intergenic
986275904 5:6274867-6274889 GGGGGCATTTGGATCATTGCTGG - Intergenic
988700351 5:33667434-33667456 GGTTGTATCTGTAGCATTTTTGG + Intronic
992040046 5:72821773-72821795 GGGAATGTCTGGAGCATTTTGGG + Intronic
995446908 5:112254764-112254786 GGGGGTATGCTGAGCATTACTGG - Intronic
995470256 5:112494280-112494302 GTGGGTACTTGGAGCAATTCAGG + Intergenic
1001184472 5:169555419-169555441 GGGGCATTCTGGGGCATTTCAGG - Intergenic
1001401159 5:171447259-171447281 GGGGGAATCAGGACAATTTCAGG - Intronic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1007041109 6:38723127-38723149 GGCGGTATCTGGAGGACCTCCGG - Exonic
1007307823 6:40920702-40920724 GGTTGTATCTGGAGCTTTTTGGG + Intergenic
1008343406 6:50395401-50395423 GGGGCTAGATGGATCATTTCTGG - Intergenic
1009253043 6:61333411-61333433 GGGGATATTTGGAGCACTTTGGG + Intergenic
1009257729 6:61435232-61435254 GGGGATATTTGGAGCACTTTGGG + Intergenic
1011034990 6:82963871-82963893 GGCAGAATCTGGAACATTTCTGG + Intronic
1011844291 6:91543950-91543972 GGAGGTATCTGGTGCATGTCAGG + Intergenic
1011905045 6:92354580-92354602 AGTGGTAGCTGGAGCTTTTCAGG - Intergenic
1015520953 6:134130781-134130803 GGAGGTATCTTGTGCATTTTGGG - Intergenic
1015881673 6:137876081-137876103 TGGGGTATCTGTAGCATTCCTGG - Exonic
1018044269 6:159952129-159952151 GGGGGATTTTGGAGCATTTGGGG + Intergenic
1024974928 7:55104532-55104554 GGGGTTATCTGAAGGATTCCAGG + Intronic
1025815783 7:64909668-64909690 GGGGGTATATAGAGTATTTTTGG + Intronic
1029507544 7:100971429-100971451 GGGGGTCTCTGGAGCCCTGCAGG + Intronic
1031865241 7:127031423-127031445 GGAGGTCTCTAGAACATTTCAGG - Intronic
1036296193 8:7540096-7540118 GGGGGTTTCTGCAGCCTGTCAGG + Intronic
1036326373 8:7780923-7780945 GGGGGTTTCTGCAGCCTGTCAGG - Intronic
1038431617 8:27504888-27504910 GGGGGTATCTGGAGCATTTCAGG + Intronic
1040273879 8:45989918-45989940 GGGGATATATGGAGCACTTTGGG + Intergenic
1049583288 8:143422228-143422250 GGAGGTATCTGGAACATGCCAGG - Intronic
1050427475 9:5526341-5526363 TAGGGTATGTGAAGCATTTCTGG - Intronic
1051225079 9:14890630-14890652 GAGGGTATCTAAAACATTTCTGG + Intronic
1054992058 9:71339762-71339784 GGGGGTAGCAGGAGAATTTTGGG + Intronic
1057783851 9:98072197-98072219 GGGGCTATCTGGAGGATTCAGGG + Intronic
1061638155 9:131928660-131928682 GGGAGTATTTGGACCAGTTCTGG + Intronic
1061720426 9:132547723-132547745 TGGTGTCTCTGGACCATTTCAGG - Intronic
1061762449 9:132859915-132859937 GGGGGTTTCTGCAGTATTACTGG + Intronic
1062358084 9:136174502-136174524 TGGGGTATCTGGAGTATCTGGGG + Intergenic
1062358188 9:136175007-136175029 TGGGGTGTCTGGAGTATCTCGGG + Intergenic
1062470860 9:136703610-136703632 GGGGGGCTCTGGCCCATTTCAGG + Intergenic
1203411231 Un_KI270579v1:7404-7426 GGGGATATTTGGAGCGTTTTGGG - Intergenic
1203415077 Un_KI270584v1:1918-1940 GTGGATATTTGGAGCATTTTGGG - Intergenic
1186779156 X:12895894-12895916 CTGGGTATCTGGGACATTTCTGG - Intergenic
1190744979 X:53317161-53317183 GGGGGTATGTGGACAATTCCAGG + Intronic
1193273563 X:79557264-79557286 GGGTGTATGTGGAGTATGTCAGG - Intergenic