ID: 1038432153

View in Genome Browser
Species Human (GRCh38)
Location 8:27509056-27509078
Sequence TAGAGAAAAAAGCAGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 674}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038432153_1038432162 12 Left 1038432153 8:27509056-27509078 CCCCCATCCTGCTTTTTTCTCTA 0: 1
1: 0
2: 2
3: 53
4: 674
Right 1038432162 8:27509091-27509113 CTCTAGGGACCTAATGTAAGTGG No data
1038432153_1038432160 -3 Left 1038432153 8:27509056-27509078 CCCCCATCCTGCTTTTTTCTCTA 0: 1
1: 0
2: 2
3: 53
4: 674
Right 1038432160 8:27509076-27509098 CTATGAATTGGACTCCTCTAGGG No data
1038432153_1038432159 -4 Left 1038432153 8:27509056-27509078 CCCCCATCCTGCTTTTTTCTCTA 0: 1
1: 0
2: 2
3: 53
4: 674
Right 1038432159 8:27509075-27509097 TCTATGAATTGGACTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038432153 Original CRISPR TAGAGAAAAAAGCAGGATGG GGG (reversed) Intronic
900701846 1:4053434-4053456 TGGTGAACACAGCAGGATGGGGG - Intergenic
901397569 1:8992572-8992594 TAGAGAACAAAGCAGCAGGAAGG - Intergenic
903202005 1:21748917-21748939 TGAAGAAAAAAACAGGAGGGAGG + Intronic
903424320 1:23242361-23242383 TAGTGAAAAAAGCAAGGTGCAGG + Intergenic
903577019 1:24345360-24345382 CAGGGAGAAAAGCAGGCTGGGGG - Intronic
903578168 1:24351985-24352007 TAGAGGAACAAGCAGGAGGCAGG - Intronic
903667217 1:25015466-25015488 TGGAGAAGAAATCAGGCTGGGGG - Intergenic
903799460 1:25955717-25955739 AAGAGAAAAAGGAAGGAAGGAGG + Intergenic
903953299 1:27008966-27008988 AAAAAAAAAAAGAAGGATGGAGG - Intronic
905520950 1:38599210-38599232 TAGAGAAGAAAGCAGGGTAAAGG - Intergenic
906037995 1:42764927-42764949 TAGAGAGTAAAGAAGGCTGGGGG - Intronic
906788828 1:48640971-48640993 TAGAGAAAAAGGCAGCTTGGCGG + Intronic
907574216 1:55511361-55511383 AAGACAAAAAAGCAGGACTGTGG + Intergenic
907770105 1:57452995-57453017 AAAAGAAAAAAGAAGGAGGGAGG + Intronic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
909100603 1:71343499-71343521 TTAAGGAAAAAGCAAGATGGGGG - Intergenic
909268769 1:73596705-73596727 TTGAAAAAAAATCAGAATGGTGG + Intergenic
909594399 1:77389518-77389540 TGCAGAAAAAAGGAAGATGGAGG + Intronic
909686988 1:78360847-78360869 GAGAGAAATGACCAGGATGGTGG + Intronic
910241667 1:85093273-85093295 AAGAGAAAAAAACATCATGGTGG - Intronic
910267342 1:85351768-85351790 AAGGGCAGAAAGCAGGATGGTGG + Intronic
911292973 1:96080483-96080505 AGGAGAAAGAAGCAGGAAGGAGG + Intergenic
911433764 1:97828005-97828027 TAGAGAACAGAGCTGAATGGTGG + Intronic
911844524 1:102733863-102733885 TGAAGAAAAAATTAGGATGGGGG + Intergenic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913076575 1:115345197-115345219 TATAGAAATAAACAGGAAGGAGG - Intergenic
915075567 1:153306036-153306058 CAGCGACAACAGCAGGATGGTGG + Intronic
915406984 1:155667528-155667550 TAAATAAAAAAGAAGGCTGGGGG + Intronic
915614886 1:157029951-157029973 TAGAGAAAAAAGTAGATTAGTGG + Intronic
916485851 1:165257828-165257850 TAGACAAAAAAGCAGAAGGATGG + Intronic
917105258 1:171485528-171485550 GAGAAAAAGAAGCAAGATGGCGG - Intergenic
917307196 1:173638710-173638732 TAAATCAAAAAGCAGGAAGGTGG + Intronic
917659087 1:177160248-177160270 TGGAGAAAACAGAAGAATGGGGG - Intronic
918224580 1:182469964-182469986 TAGAGAAAGAAGTAGAATGGTGG + Intronic
918241719 1:182626164-182626186 TAGAGGAATCAGCAGGAAGGTGG - Intergenic
918282426 1:183020417-183020439 GAGAGAAAAAGGAGGGATGGAGG - Intergenic
919058868 1:192606057-192606079 GAAAGAAAAAAGAAGGAGGGAGG + Intergenic
919468871 1:197954311-197954333 TTGAGGAAAAGGCAAGATGGAGG - Intergenic
919478072 1:198053970-198053992 TAGAGCAACAAGCAGGATATTGG - Intergenic
919670711 1:200335227-200335249 TAGAGAGCAAAGCTGGAGGGAGG + Intergenic
919675112 1:200374397-200374419 TAGAGAGAGAAGAATGATGGTGG + Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920729784 1:208472568-208472590 TAGTGAAAAAAAGTGGATGGGGG + Intergenic
920752232 1:208689823-208689845 TAGAGAAGAAATCAGGATAATGG - Intergenic
921203925 1:212831943-212831965 AACAGAAAACAGCAGGGTGGGGG - Intronic
921563778 1:216691197-216691219 TAAAGAAAAATGCAGGATTTAGG + Intronic
921781298 1:219168179-219168201 TAGAAAAAAAAGTATAATGGTGG - Intergenic
921990574 1:221361539-221361561 TAGTGAAAAAATGAAGATGGTGG + Intergenic
922006828 1:221539654-221539676 TAGATAATAAAGCAGGTCGGAGG - Intergenic
922957398 1:229614898-229614920 TAGCCAAAAAAGCAGGCAGGAGG + Intronic
923886610 1:238164544-238164566 TAGAGCAAAAAGCAGGCTCTTGG - Intergenic
924354351 1:243154478-243154500 TGGAGAAAAAAGGAGGGTGGTGG - Intronic
1062991665 10:1825159-1825181 GAGAGAAGAAAGCTGGGTGGGGG - Intergenic
1063164813 10:3451676-3451698 TAGAGGAAAGAGGAGGAGGGAGG - Intergenic
1063460495 10:6212352-6212374 AAGACAAAACAGCAGGAAGGGGG - Intronic
1064008988 10:11720213-11720235 AAGAGAAAGAAGCAGTCTGGGGG + Intergenic
1064242231 10:13641090-13641112 TAGATAAGAAAGCAGGATAGTGG - Intronic
1064319152 10:14285942-14285964 TAGTCAAAAACGCAAGATGGCGG + Intronic
1064835889 10:19529530-19529552 GACAGAAAAAAACAGGAGGGGGG + Intronic
1065625182 10:27623002-27623024 TGGAAAAAAAAGCAGGGTGTGGG - Intergenic
1065728497 10:28689745-28689767 TAAAGAAAAAAGCAGGAAGCAGG - Intergenic
1066386863 10:34948521-34948543 AAAAGAAAAAAGAAAGATGGAGG + Intergenic
1066698373 10:38099308-38099330 TAGAACAGAAAGTAGGATGGTGG - Intronic
1067256994 10:44651126-44651148 TAAAGACAACAGCAGGGTGGAGG - Intergenic
1068105984 10:52616961-52616983 TATATAAAGAAGCAGGATAGAGG + Intergenic
1068574722 10:58672272-58672294 GAGAGAAGAAAGTAGAATGGTGG - Intronic
1068721153 10:60247544-60247566 CGGAGACAAAAGTAGGATGGTGG - Intronic
1068903034 10:62291278-62291300 GAGTGAAAAAAGCAGAATTGTGG + Intergenic
1069696260 10:70387704-70387726 TATAGCAAAAATCAGGAAGGTGG - Intergenic
1070282279 10:75058555-75058577 ATGAGAGAGAAGCAGGATGGGGG + Intergenic
1071148142 10:82599285-82599307 TAGAGATAAATGCAAGTTGGTGG + Intronic
1071778094 10:88811577-88811599 TAGAGAATAGAGAAGGATGAAGG - Intronic
1071817227 10:89245259-89245281 TACACAAAAAAGCAGGAAGTAGG + Intronic
1072206005 10:93205727-93205749 TGGAGAAAAAAGCAAAAAGGAGG + Intergenic
1072504873 10:96055790-96055812 TAAAGAAAAAAGGGGCATGGGGG - Intronic
1072946800 10:99817528-99817550 AAGAGAAAAAGTGAGGATGGTGG + Intronic
1072957097 10:99896882-99896904 TAGAGATAAAAGTAGAAGGGTGG + Intronic
1073111404 10:101065087-101065109 TAGAGACAAAAGCTGGAGGAGGG + Exonic
1073566548 10:104540222-104540244 TAGAAAAAAGAGCAAGATGAAGG + Intergenic
1073964273 10:108970402-108970424 TAGAGAACAAAGCAATGTGGAGG - Intergenic
1074104518 10:110378525-110378547 TATATAAAAAAACAGTATGGAGG - Intergenic
1074213252 10:111357964-111357986 TACAGAAAATAGTAGGAGGGGGG + Intergenic
1075238763 10:120758228-120758250 TTGAGACAATAGCAGGAAGGGGG - Intergenic
1075741524 10:124699095-124699117 GAGAGAGAAAAGCAGGTGGGAGG - Intronic
1075780951 10:125016756-125016778 TAGAGAAGAAAGAAGAGTGGAGG - Intronic
1076225085 10:128768138-128768160 TAGAGTACAAAGCAGAAAGGTGG + Intergenic
1076268829 10:129132814-129132836 TTGAGAAAGAGGCAGGATGCAGG - Intergenic
1077561088 11:3261810-3261832 GAAAGGAGAAAGCAGGATGGGGG - Intergenic
1077566984 11:3307640-3307662 GAAAGGAGAAAGCAGGATGGGGG - Intergenic
1077957556 11:7037399-7037421 TGGAAAAAAAAGACGGATGGGGG - Intronic
1078182378 11:9022860-9022882 TAGAGAAAAAAGCGGGAGGTGGG - Intronic
1078466086 11:11551574-11551596 GAGAGAACAAAGCAGGGTGAAGG + Intronic
1078686445 11:13536695-13536717 TCGTGAAAAGAGCAGTATGGGGG - Intergenic
1078688111 11:13551532-13551554 TAGATAAAAGAGGAGGTTGGGGG + Intergenic
1079338347 11:19590741-19590763 TAAAGAAAAAACCATAATGGTGG - Intronic
1079807134 11:24946621-24946643 TAGAAAAAAAAGAAGGGTTGGGG - Intronic
1079950968 11:26803924-26803946 GTGAGAAAAAAGGAGCATGGTGG - Intergenic
1080077427 11:28167480-28167502 TAGAGAAAAAAGTACTACGGTGG - Intronic
1081330167 11:41791975-41791997 GAAAGAAAAAAACAGGTTGGAGG + Intergenic
1081415126 11:42805593-42805615 TAGAGACAGAAGTAGAATGGTGG + Intergenic
1081628762 11:44672813-44672835 TACAGAAACAAAGAGGATGGAGG + Intergenic
1082060350 11:47854836-47854858 TAAAAAAAAAAGCAGAATTGTGG + Intergenic
1082757052 11:57087731-57087753 GAGAGCAGAAAGCAGGAGGGAGG + Intergenic
1082960516 11:58914789-58914811 TGGAGAAAAATGCATTATGGGGG + Intronic
1083903226 11:65654029-65654051 TAGAGACAGAAGCAGGCTGGAGG - Exonic
1085190725 11:74619442-74619464 TTGGGAAAGAAGAAGGATGGAGG + Intronic
1086000236 11:81974766-81974788 AAGAGAAAAGAGCAAGAGGGAGG - Intergenic
1086494931 11:87393008-87393030 GGGAGAAAAAAACAGGATGGAGG - Intergenic
1086523931 11:87703082-87703104 AACAGAACAAAGCTGGATGGAGG - Intergenic
1086720857 11:90119400-90119422 TAGAGGAAGAAGGAGGATGTTGG + Intergenic
1086731709 11:90257764-90257786 TAAAGACATCAGCAGGATGGAGG - Intergenic
1086761710 11:90639384-90639406 AAGAGAAAAAAGGAGAGTGGGGG + Intergenic
1087220337 11:95540193-95540215 TATAGAAAAAATTATGATGGAGG + Intergenic
1088187672 11:107191072-107191094 TAGAGACAAAGGAAGGCTGGTGG + Intergenic
1088489656 11:110374482-110374504 CAAAGAAAAAAGGAGGAAGGAGG - Intergenic
1088584231 11:111346643-111346665 TAAAGAAAATAGCAAGATGTCGG - Intergenic
1088987068 11:114918531-114918553 TTGAGATAAATGCAGGCTGGAGG + Intergenic
1089124726 11:116168735-116168757 AAGAGACAAAAGCAGAGTGGGGG - Intergenic
1089342536 11:117768331-117768353 TTGAGATAAAAACATGATGGTGG + Intronic
1089409935 11:118232330-118232352 TGGAGAAAAAAGCAGAAAAGGGG - Intronic
1090096105 11:123742866-123742888 TGGAGAAATAAGGAGGTTGGTGG + Intergenic
1090132475 11:124159151-124159173 CATGTAAAAAAGCAGGATGGCGG - Intergenic
1090347869 11:126085256-126085278 TAGAGACACAAGCAGGGTGTGGG - Intergenic
1090975107 11:131673336-131673358 TAGAGGACAAAGGAGGCTGGTGG + Intronic
1091638663 12:2217214-2217236 TAGAGACAGAAGTAGAATGGTGG + Intronic
1091807080 12:3364515-3364537 TAAAGGTAAAAGCAAGATGGTGG + Intergenic
1091864919 12:3824621-3824643 GAGAGAACTAAGCAGAATGGAGG - Intronic
1092015938 12:5158321-5158343 TAGAGAAAAAAGCACTGTGTTGG - Intergenic
1092388511 12:8054477-8054499 GAAAGAAAAAAGCAGGAGAGCGG - Exonic
1092801843 12:12176189-12176211 TATAGTAAAAATCAGGAGGGGGG + Intronic
1092893538 12:12991782-12991804 AAGAGAAGAAAACAGGATAGGGG - Intronic
1093039821 12:14365348-14365370 TAGAAAAGAAAGAAGGAAGGAGG - Intergenic
1093055851 12:14554928-14554950 GAGAGAAAACACCACGATGGAGG - Intronic
1093538204 12:20248095-20248117 TAGAGAATTAAGCAGGATCTCGG + Intergenic
1093667705 12:21834230-21834252 TAGGCAAAAAATCAGGATAGTGG - Intronic
1093692275 12:22121871-22121893 CAGAGAAAGAAGGAAGATGGGGG - Intronic
1094026883 12:25968825-25968847 TAGAGAAAAAAATAAGGTGGGGG + Intronic
1095812206 12:46383341-46383363 AAGAGAGAAAAGGAGGAGGGAGG + Intergenic
1096267592 12:50136131-50136153 TAGAGAATAATGCAGGACGTTGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1099783892 12:87236450-87236472 GAGAAAAAAAAGCAGGCCGGGGG + Intergenic
1099855342 12:88157541-88157563 TAGAGAAAAAAAGAGGATGAAGG - Intronic
1100288885 12:93194562-93194584 TAAAGAAAAAGACAGGCTGGTGG + Intergenic
1100806640 12:98292466-98292488 AAGAGAGAAAAGAAGAATGGAGG + Intergenic
1100933524 12:99637981-99638003 GTCAGAGAAAAGCAGGATGGGGG - Intronic
1100935608 12:99661693-99661715 TAAAGACAAAAGGAGGAGGGGGG - Intronic
1101347771 12:103902184-103902206 TAGAGAAAGAAGCAGGGTGTAGG - Intergenic
1101559852 12:105846301-105846323 GAGAGAAAAGAGCTGGATTGAGG + Intergenic
1102514561 12:113437679-113437701 GAGAGATAAAAGGTGGATGGTGG + Intronic
1102692779 12:114774432-114774454 TAGAGAAGAAGGCAGGCTGTGGG + Intergenic
1103172537 12:118833949-118833971 AAAAGAATAAAGGAGGATGGAGG + Intergenic
1103680079 12:122686613-122686635 TAGAGCAAAAAGCAAGTTGCTGG - Intergenic
1104200840 12:126587214-126587236 TAGAGACAGAAGTAGAATGGTGG + Intergenic
1105405969 13:20132934-20132956 TAGAACAGAAAGCAGAATGGTGG - Intergenic
1106509002 13:30396949-30396971 TAGAGACAACAGCAGAATGGTGG - Intergenic
1106947956 13:34849565-34849587 TGGAGAATAAAGCATAATGGAGG - Intergenic
1107087774 13:36444559-36444581 GGGAAAAAAAAGCAGGGTGGAGG - Intergenic
1107132040 13:36907197-36907219 TAGAGAAGAAAGTAGAATGAAGG + Intronic
1107649130 13:42526531-42526553 AAGAGAAAGAGGCAGGGTGGGGG + Intergenic
1107819639 13:44274621-44274643 TAGAGAAAAGAACAAAATGGAGG + Intergenic
1109175199 13:59146468-59146490 CAGAGAAAAGAGCAAGATGATGG + Intergenic
1110504669 13:76271801-76271823 TAGAAAAAAATGGAGGAAGGAGG + Intergenic
1111027131 13:82542778-82542800 TAGAGAAAAAATTTGGGTGGAGG + Intergenic
1111137968 13:84075424-84075446 TAGAGTAATTAGCAGAATGGTGG - Intergenic
1111477044 13:88762978-88763000 TAGAGAAGAAAGCCTAATGGTGG + Intergenic
1111727957 13:92036857-92036879 TAGAGAGAAATACTGGATGGTGG - Intronic
1111860497 13:93698821-93698843 GAGAGAAAAAAGGAAGAAGGAGG - Intronic
1112393786 13:99009688-99009710 CAGACACACAAGCAGGATGGGGG + Intronic
1113606699 13:111612998-111613020 TAGAGAAAAGCACAGGGTGGCGG + Intronic
1114660867 14:24343384-24343406 TAGAGATGAAAGTAGAATGGTGG + Intergenic
1114746153 14:25149637-25149659 TAAAGAAAAAAGGGGGAGGGAGG + Intergenic
1115663222 14:35518342-35518364 TAGATAAAAAGGCAAGTTGGGGG - Intergenic
1116237675 14:42300185-42300207 TAGAGAATAAAGAAGGAGAGAGG + Intergenic
1116330886 14:43596561-43596583 TAGGGCTAAAAGCAGGGTGGAGG + Intergenic
1116722937 14:48524165-48524187 TAGAGAAAAAAGTAGGAAATTGG + Intergenic
1116759851 14:48998605-48998627 TTAAAAACAAAGCAGGATGGGGG + Intergenic
1116824105 14:49655058-49655080 CACAGAATAAAGCAGGTTGGAGG + Exonic
1116967041 14:51025774-51025796 TAGAGTAAAGAACAGGATGAAGG + Intronic
1117718399 14:58604063-58604085 AAGAGGAAACACCAGGATGGGGG - Intergenic
1117857823 14:60053903-60053925 TTGAGAAAAAAAGAGGCTGGAGG + Intronic
1118121113 14:62844233-62844255 TAGAGAAAAAAGTAAGATATTGG + Intronic
1118147492 14:63156416-63156438 TGGGGAAAAAAGAACGATGGGGG - Intergenic
1118163488 14:63313856-63313878 TGGAAAATAAAGCAAGATGGGGG - Intronic
1118613724 14:67561252-67561274 TAAAGGAAAATGCAGGCTGGGGG + Intronic
1120286707 14:82511571-82511593 TAGAGAAGAAAGGCAGATGGTGG - Intergenic
1120387780 14:83867479-83867501 GTGAGAAAAAAGCTGGGTGGAGG - Intergenic
1121019142 14:90568298-90568320 TAGGGAGCAAAGCAGGAAGGAGG + Intronic
1121032758 14:90673430-90673452 AAGAGAAAAAAGAAGGAGCGCGG + Intronic
1121085102 14:91139892-91139914 AAGGGGAGAAAGCAGGATGGAGG + Intronic
1121391554 14:93580355-93580377 TAAAGAAGAAAGCCGGCTGGTGG + Exonic
1121836660 14:97098416-97098438 TTGAGAAAGAAGCAGGGAGGGGG + Intergenic
1121840829 14:97132406-97132428 GAGAGAACAAAACAAGATGGTGG - Intergenic
1121950043 14:98163687-98163709 TAGAGAAGAAAGTAGGAGGATGG - Intergenic
1122487881 14:102093970-102093992 AAAAGAAAAAAGAAGGAAGGTGG + Intronic
1122581610 14:102775374-102775396 AAAAAAAAAAAGTAGGATGGTGG - Intergenic
1123792558 15:23736823-23736845 GAGAGAAAAAAGCAGTCTAGAGG + Intergenic
1123802177 15:23832625-23832647 TAGATGTAAAAGTAGGATGGTGG - Intergenic
1123885888 15:24728086-24728108 TAAAGAAAGCAGCAGGAAGGTGG - Intergenic
1124044973 15:26140327-26140349 TGGAGAAAAAGGTGGGATGGGGG + Intergenic
1125039115 15:35162626-35162648 AAGAGAAAAAAGCAGGGTAAGGG - Intergenic
1125092776 15:35813679-35813701 TAGTGAATAGAGCAGGATAGAGG + Intergenic
1125181543 15:36885337-36885359 TAGAGAAAAAGGAAGGCAGGTGG + Intergenic
1125431532 15:39599527-39599549 GAGAGAAAGAAGGAGGAGGGAGG - Intergenic
1125717743 15:41828637-41828659 AATAGAAAAAAGAAGGAAGGAGG - Intronic
1125834775 15:42739435-42739457 TAGGGAAAAAAGAGGGAGGGGGG - Exonic
1126347567 15:47712336-47712358 TAGAAAAAAAATAAGGATTGAGG + Intronic
1126451472 15:48813376-48813398 TGGAGAAGAAGGCAGGAAGGAGG + Intergenic
1127038154 15:54942702-54942724 AAAAGGAAAAAGCAGGCTGGAGG - Intergenic
1128396281 15:67229581-67229603 GAAAGAAAAAAGGAGGAAGGAGG + Intronic
1128782097 15:70366825-70366847 TATAAAAAAAAACAGTATGGAGG + Intergenic
1128954792 15:71928377-71928399 AAAAGAACAAAGCTGGATGGAGG - Intronic
1131266170 15:90916579-90916601 TGGAGAAAAAGTCAGGCTGGTGG - Intronic
1131292901 15:91122539-91122561 TGGAGAGGAAACCAGGATGGGGG - Intronic
1131931917 15:97452142-97452164 TACAGAGAACAGCAGGATAGGGG + Intergenic
1132097828 15:99000804-99000826 GAGAAAAAAAAGCAGGCTGCGGG + Intronic
1132473993 16:123321-123343 TAGAGAAAAAGCCGGGGTGGTGG + Intronic
1132835732 16:1952325-1952347 TGGAGATGAAATCAGGATGGAGG - Intronic
1133088021 16:3380252-3380274 TAGAGGACAAAGCAGCCTGGAGG + Intronic
1133290352 16:4716567-4716589 CAGAGTCAAAAGTAGGATGGGGG - Intronic
1133569936 16:7031293-7031315 TAGAGATAAAAGCAGTATCATGG + Intronic
1135770583 16:25215147-25215169 TAGAGACAGAAGTAGAATGGTGG - Intergenic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1136074799 16:27809657-27809679 GAGAGAAAAGAGAGGGATGGAGG - Intronic
1137442862 16:48511081-48511103 CAGGAAACAAAGCAGGATGGTGG - Intergenic
1137548528 16:49420707-49420729 TTAAGAAAAAAGTATGATGGGGG - Intergenic
1138386268 16:56637842-56637864 TAAACTAAAAAGCAAGATGGGGG - Intergenic
1138810330 16:60141471-60141493 TTGAAAAAAAAGAAGGATGGAGG + Intergenic
1139073044 16:63406848-63406870 TAGAAAAAAAAAAAGGATTGTGG + Intergenic
1139322006 16:66122507-66122529 GTGAAAATAAAGCAGGATGGGGG + Intergenic
1140450965 16:75070464-75070486 TAAAGAGGAAAGCAGGATCGGGG - Intronic
1140684748 16:77422609-77422631 GAGAGAAAAAAGGAGGAAGAAGG + Intronic
1140754381 16:78054468-78054490 AAGGGAAAAAAGCAGCATTGTGG - Intronic
1140840439 16:78833362-78833384 TAGAGAAACAAGCTGTATGCAGG - Intronic
1141412910 16:83847760-83847782 AAAAAAAAAAAGCAGGGTGGAGG - Intergenic
1142468945 17:151894-151916 TAGAGAAAACAGCAGAACAGAGG - Intronic
1142845807 17:2675390-2675412 TAGAAAAATAAGTGGGATGGGGG - Intronic
1143091264 17:4450253-4450275 GAGAGAAAAGAGGAGGAAGGAGG - Intronic
1143882426 17:10039909-10039931 AAGAGAAAAGACCAGGAAGGTGG - Intronic
1143915180 17:10286426-10286448 TAGGGAGAAAAGAGGGATGGAGG - Intergenic
1143982527 17:10882287-10882309 TAGAGAAAAGAGCATCCTGGAGG + Intergenic
1144195854 17:12894420-12894442 TAGAGAAAGAACCTGGATGCTGG - Intronic
1144295046 17:13866287-13866309 AAGAGAAGGAAGCAGGATTGTGG - Intergenic
1144295509 17:13871469-13871491 TAAAGAAAAAATCAGGACAGGGG + Intergenic
1146552631 17:33794851-33794873 TAGAGAAAACACCAGGACTGGGG + Intronic
1146932233 17:36785463-36785485 TAGAGAAGAATCCAGGGTGGGGG - Intergenic
1146961263 17:36982031-36982053 CAGAGAGAAAAGCAGAATGGTGG - Intronic
1148866529 17:50631619-50631641 GAGAGAAGAAAGCAGAATGGGGG - Intergenic
1148952325 17:51324343-51324365 AAGAAAAAAAAGAGGGATGGAGG - Intergenic
1149159327 17:53671981-53672003 TAGAGAAAGAAGAAGTGTGGTGG + Intergenic
1149364483 17:55928528-55928550 AAGAAAATAAAGCAGGATAGGGG + Intergenic
1150008041 17:61481708-61481730 TGGAGAAAACAGGAGGAGGGAGG + Intronic
1150303457 17:64064893-64064915 TAGAGAAACTAACAGGGTGGAGG + Intronic
1150486006 17:65544270-65544292 AAAAAAAAAAAACAGGATGGGGG + Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150550370 17:66204278-66204300 TAGAGCACAAAGCAGGATCCTGG + Intergenic
1150554347 17:66240314-66240336 GAAAGAAAAAAAAAGGATGGAGG + Intronic
1150638897 17:66936220-66936242 TAGAGACAAAAGTAGAATGGTGG - Intergenic
1151121358 17:71796802-71796824 TAGAAAAGAAAGCAGGGAGGTGG + Intergenic
1151307476 17:73272571-73272593 TACAGAATAAAGCAGGACTGGGG - Intergenic
1151558118 17:74857119-74857141 TTTAGAAAAAAGGAGGTTGGAGG - Intronic
1151947536 17:77327727-77327749 TAGAAAAAAAAAGAGGAGGGTGG - Intronic
1203171336 17_GL000205v2_random:149785-149807 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1154144723 18:11857565-11857587 TAGAGCATAAAGCAGGGAGGTGG + Intronic
1155256541 18:24002720-24002742 TGTAGAAAAAAGCAGAATCGTGG + Intronic
1155313731 18:24550325-24550347 GAGAGAAAAATGCTGGGTGGTGG - Intergenic
1155958835 18:31976981-31977003 TAAACCAGAAAGCAGGATGGTGG - Intergenic
1156351304 18:36303617-36303639 TGGAGAGAAAAGGAGGGTGGGGG - Intronic
1156901069 18:42300602-42300624 TAGAGAGAAATGCAGCATGCTGG + Intergenic
1157426870 18:47591643-47591665 GAGAGAAGGAAGCAGGGTGGAGG + Intergenic
1157971456 18:52274280-52274302 TAGAGACAAATCCAGGCTGGAGG - Intergenic
1158377087 18:56883220-56883242 AAAAAAAAAAAGCAGGAAGGTGG + Intronic
1159385318 18:67717244-67717266 TAGAGACTACAGCTGGATGGAGG + Intergenic
1159560791 18:69991360-69991382 TAGAAAAAAAAGCAGACTGCTGG + Intergenic
1160521040 18:79508206-79508228 TGGAGAAAAAAGGTGGAGGGAGG + Intronic
1161918771 19:7250559-7250581 TAAAGAAAAAGGAAGGAAGGAGG + Intronic
1162074989 19:8180432-8180454 TACAGAAAAAAGCAGGATATTGG + Intronic
1162082247 19:8225171-8225193 TAGAGAAAACAGCAGAGAGGAGG + Intronic
1162248193 19:9420458-9420480 TAAAGAAAAAATCAGGCCGGGGG + Exonic
1164805865 19:31116092-31116114 TAGAGAACAAGGCAGGGTAGAGG + Intergenic
1165139139 19:33688710-33688732 TACAGAGAGAAGCAGGGTGGAGG + Intronic
1165294102 19:34912312-34912334 TAGAGAATAAAGCAGTTTGTGGG + Intergenic
1165370187 19:35400504-35400526 GAAAGAAAAAAGAAGGAAGGAGG + Intergenic
1165393736 19:35552757-35552779 TAGGGAAAATAGCAGAATAGGGG + Intronic
1165578922 19:36845546-36845568 TAAAGCAAAAATGAGGATGGAGG + Intronic
1166261040 19:41640979-41641001 TAGAGGAAAAAGCTGGGTTGGGG - Intronic
1167024007 19:46901204-46901226 GTGAGAAAAAGGCAGAATGGTGG + Intergenic
1167386968 19:49169239-49169261 TACAGAAAAATGCACGAAGGTGG + Intronic
1167839848 19:52106778-52106800 AAGAGAAAATAGCAGGAGGAAGG - Intergenic
1168569424 19:57453133-57453155 AAAAGAAAAGAGCAGGAGGGAGG - Intronic
926117172 2:10220911-10220933 TAGAGACAAAGGCAGAATGCTGG + Intergenic
926968688 2:18444443-18444465 TAGAGGAAAAAGGAGAAAGGGGG + Intergenic
927659595 2:24981626-24981648 TAGAGACAAAAGTAGAATGATGG - Intergenic
928467236 2:31533460-31533482 TAGAGAAAAGATCAGGGTAGAGG + Intronic
928887448 2:36165960-36165982 TAGAGACACAAGTAGAATGGGGG + Intergenic
928934179 2:36657452-36657474 GAAAGGAAAAAGCAGAATGGTGG + Intergenic
929738044 2:44572173-44572195 CAGAGACAAAAGTAGAATGGTGG - Intronic
929992657 2:46802827-46802849 TAGAGCAGAAAGCAGGAGGTCGG - Intergenic
930609657 2:53527401-53527423 TAAACAAAAAAGCAGGTTGGGGG + Intergenic
930654710 2:53996344-53996366 GAGATAAAAAAGGAGGATGGAGG + Intronic
930882803 2:56291453-56291475 CAGAGAAAATAGCAGTGTGGGGG + Intronic
930926622 2:56825976-56825998 TAGAGAAAACAGCTGGATTCTGG - Intergenic
931458423 2:62430514-62430536 TAAAGACAGAAGCAGGATGGTGG + Intergenic
931705392 2:64942659-64942681 AAGAGAATAAAGCAGCATGAGGG + Intergenic
931862965 2:66376342-66376364 CAGAAAAAATAGCAGTATGGAGG - Intergenic
932376603 2:71241509-71241531 TAGAGAAAAAAGCACTGTGTGGG - Intergenic
933074442 2:77905656-77905678 TAGAGAAAAAAGCACAAAGATGG + Intergenic
933716729 2:85367013-85367035 TGGAGAAAAGGGCCGGATGGTGG + Intronic
934576570 2:95405527-95405549 CAGAGAAAAATGCAGGATCCAGG - Intronic
934638794 2:96013698-96013720 CAGAGAAAAATGCAGGATCCAGG - Intergenic
935060396 2:99602052-99602074 TAGAGGAAAATGCAGCATGATGG + Intronic
935236517 2:101143376-101143398 TAAAGTAAAAAGCAGGAAGCAGG + Intronic
935841956 2:107123180-107123202 TTGAGAAAACAGCAAGAAGGTGG + Intergenic
936023370 2:109012577-109012599 AAGAGGAGAAAGCAGGGTGGAGG - Intergenic
938792194 2:134686380-134686402 TACATATTAAAGCAGGATGGTGG + Intronic
941225181 2:162839000-162839022 GAGAGAGAAAAGGAGGCTGGGGG + Intergenic
941425032 2:165332693-165332715 TCTAAAAAAAAGCAGGGTGGTGG + Intronic
941959731 2:171241740-171241762 AAGAGAAAAAAGGAGGGTGAGGG - Intergenic
942211752 2:173678231-173678253 GAGAGAAAGAAGCAAGAGGGAGG + Intergenic
943307180 2:186277369-186277391 TAGAGCAAAAAATGGGATGGGGG + Intergenic
943407071 2:187502481-187502503 TTGAGAAAAAAGCCGAATGAGGG + Intronic
943566775 2:189525538-189525560 TATAGAAAAATGCAGGCTGAGGG + Intergenic
943620377 2:190141598-190141620 TCAAGAAAACAGCAGCATGGGGG + Intronic
944165723 2:196717892-196717914 AAAAAAAAAAAGCAGGATGAAGG + Intronic
944349406 2:198709188-198709210 GAGAGAAAAAAGAAGGGAGGAGG - Intergenic
944428880 2:199612026-199612048 AAGAGGAAATAACAGGATGGGGG - Intergenic
944483352 2:200179281-200179303 TATTAAAAAAAGCAGGAAGGGGG - Intergenic
944827586 2:203501027-203501049 TAGAGAAAGGGGCAGGAGGGAGG + Intronic
945023349 2:205596202-205596224 AAGAGACCAAGGCAGGATGGGGG + Intronic
945324996 2:208471830-208471852 TTGTGAAAGAAGCAGGAGGGGGG + Intronic
945445379 2:209931947-209931969 TAGAGACAAAAGCAGTGTGAAGG - Intronic
945695588 2:213099204-213099226 TATAAAAGAAAGGAGGATGGGGG - Intronic
946573353 2:221048547-221048569 TGGAAAATGAAGCAGGATGGAGG - Intergenic
947375371 2:229489895-229489917 CAGAGAGAAAAGCAGCATGAGGG + Intronic
947389486 2:229624268-229624290 AAGAGAAAAAAGCAGGAAGATGG + Intronic
947684714 2:232072715-232072737 TGGAGACTAAACCAGGATGGTGG + Intronic
947838090 2:233189495-233189517 TAGAGGAGAAGGCAGGCTGGCGG - Intronic
948042971 2:234918756-234918778 TAGAGAATAAATCAGGTAGGAGG + Intergenic
1168995887 20:2132967-2132989 CAAACAAAATAGCAGGATGGGGG - Intronic
1169515136 20:6308645-6308667 TAGAGTAGAAAGTAGAATGGTGG - Intergenic
1170095853 20:12645362-12645384 TAGACTAGAAAGCAGCATGGAGG + Intergenic
1170451107 20:16484903-16484925 TAGAGAAAAAAGGATGCTCGTGG + Intronic
1170936252 20:20812419-20812441 TAGAGGAAAAGGCAGGCTGGCGG - Intergenic
1171046513 20:21812996-21813018 TACAGAAACAAGTGGGATGGAGG + Intergenic
1171099126 20:22365957-22365979 TAGAAAAAATAACAGGAAGGTGG - Intergenic
1172153029 20:32803913-32803935 TATAGACAATAACAGGATGGAGG + Intronic
1172250855 20:33478121-33478143 TATGGAAAAGAGCAGGATGAAGG - Intergenic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1173112740 20:40208719-40208741 TAACGAAAACAGCATGATGGTGG + Intergenic
1174187530 20:48717223-48717245 AAGAGAAAAAGGCAGGAGGGTGG + Intronic
1174207041 20:48847805-48847827 TATAGAAATCAGAAGGATGGGGG - Intergenic
1174672080 20:52318026-52318048 TAGAAAATAAAGCAGGAAAGGGG + Intergenic
1175082566 20:56433329-56433351 TAGAGAGAACAGCATGATGGAGG + Intronic
1175333602 20:58180803-58180825 CACAGAAAGAAGCAGGAGGGAGG - Intergenic
1176327320 21:5511613-5511635 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176400437 21:6309338-6309360 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1176436720 21:6679766-6679788 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176460982 21:7006836-7006858 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176484543 21:7388614-7388636 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1178130458 21:29566005-29566027 TAGATAAAAAAGTAGAATGTTGG + Intronic
1178327339 21:31656645-31656667 AAGAGAAAGAAGAAGGAAGGAGG - Intergenic
1178940703 21:36902648-36902670 AAGAGAGAAAAGAAGGAAGGAGG + Intronic
1179261599 21:39762946-39762968 TAGAGCAAACAGCCAGATGGGGG - Intronic
1179273324 21:39868411-39868433 GAGAGATAAAAGCAGGGAGGAGG - Intronic
1179642048 21:42754150-42754172 AAGAGGAAAAAGCAAGAAGGAGG - Intronic
1181097746 22:20517508-20517530 CAGTGAAAAGAGCAGGGTGGTGG - Intronic
1181369926 22:22407910-22407932 TGGAAAAAAAAGCAGTATGATGG + Intergenic
1182333827 22:29570065-29570087 TACAGAAAAGAACAGGGTGGAGG + Intronic
1182786882 22:32915450-32915472 TAAAAAATAAAGCAGGATGACGG + Intronic
1183661560 22:39224521-39224543 AAGAGGAAAATGCAGGGTGGAGG + Exonic
1184064633 22:42110822-42110844 TAAATAAAAAAGCAGGAAGGTGG - Intergenic
1184372505 22:44091505-44091527 TAGAGGAGAAAGCAGTCTGGTGG - Intronic
1184429949 22:44436783-44436805 TAGAGACAGAAGTAGAATGGTGG - Intergenic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184917217 22:47578067-47578089 TTTAGAAAAAAGCAGAATAGAGG - Intergenic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
949606595 3:5660358-5660380 CAGAGAATAAAGCAAGTTGGGGG + Intergenic
949920033 3:8993279-8993301 AAGAGAAAAAAGGAGGAGGTAGG - Intronic
950772567 3:15323936-15323958 AAGGGAAATAAGCAGTATGGGGG + Intronic
950903260 3:16515306-16515328 TAAAGGAAAAAGGAGGGTGGGGG + Intergenic
952196056 3:31076258-31076280 GAGCGTGAAAAGCAGGATGGTGG + Intergenic
952600060 3:35069327-35069349 TAGGGAAAAAAACAGCATGCAGG - Intergenic
952860493 3:37808393-37808415 GGGAGAAAGATGCAGGATGGTGG + Intronic
952964819 3:38614675-38614697 AAGAGAAAAGGGCAGGATGAGGG + Intronic
953909036 3:46882657-46882679 TAGAGAGAAAAGGGGGAGGGAGG + Intronic
953988223 3:47462203-47462225 AAGATAAAAAAGATGGATGGTGG - Intronic
955736625 3:62045588-62045610 TACAGAAAACAGCAGCATTGAGG - Intronic
956126572 3:66016637-66016659 AAGAAAGAAAAGCAGAATGGAGG + Intronic
956148111 3:66212669-66212691 TAGAGATAAAAGTAGCATGGTGG - Intronic
956175151 3:66465889-66465911 TAGAGACAGAAGTAGAATGGTGG - Intronic
956993398 3:74795233-74795255 AACAGAACAAAGCTGGATGGAGG + Intergenic
957204949 3:77184603-77184625 GAGAGAAAATTTCAGGATGGTGG + Intronic
957791658 3:84949627-84949649 TAGAGAACAAAGAACGCTGGTGG + Intergenic
959434274 3:106294840-106294862 AAGAGAAAAAAGAAAGATGTGGG - Intergenic
959552455 3:107678232-107678254 TAGAGAAAAAATGGGGGTGGGGG - Intronic
960644761 3:119867076-119867098 TAGAGAAAAAAGTAGCATATTGG - Intronic
960715235 3:120568678-120568700 TAGAGGAAGAAACAGGCTGGGGG + Intergenic
961015236 3:123463241-123463263 TAGGGATAAAAGCAGATTGGTGG + Intergenic
961127353 3:124432088-124432110 TAAAGAAAAAATCAGGATTGGGG + Intronic
961351515 3:126307456-126307478 GAGAGAAATGAGCGGGATGGTGG + Intergenic
961719527 3:128883654-128883676 TAGAAAAAAAAAAAGGTTGGAGG - Intronic
962377790 3:134873160-134873182 GAGAGAAAAAGGAAGGAGGGAGG + Intronic
962731478 3:138287447-138287469 TAGAGAAAATTGGAGGGTGGAGG - Intronic
963143382 3:141966722-141966744 TAGAGATAAAAGTAGGATATTGG + Intronic
963204263 3:142616327-142616349 TAGAGAAAAAAGAATGATGGAGG + Intronic
963273978 3:143312554-143312576 TAGAAAGAAAAGCAGGATGATGG - Intronic
963341972 3:144047137-144047159 TTGAGTAAAAAGGAGGAGGGAGG - Intronic
963763555 3:149309422-149309444 TGAAGAAAAAAGGGGGATGGGGG + Intergenic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
964849642 3:161081330-161081352 CACAGAAGAAAGCGGGATGGTGG + Intergenic
965123856 3:164598513-164598535 TAGAAACAAAACCAGGAAGGGGG + Intergenic
965322261 3:167265045-167265067 TAGAGCAACAAGCAGGTTCGTGG - Intronic
965979223 3:174666863-174666885 TAGAAACAAAAGGAGAATGGTGG - Intronic
966639469 3:182173636-182173658 TAGAAAAAAAAGCTGGATTCTGG + Intergenic
966818002 3:183904958-183904980 TAAAAAAAAAAGCATTATGGAGG + Intergenic
966818654 3:183908499-183908521 TAAAGGAAAAATCAGGTTGGTGG - Intergenic
967301925 3:188022609-188022631 CAGGGGAAAAGGCAGGATGGAGG - Intergenic
968034195 3:195531888-195531910 TAGAGATAGAAGTAGAATGGTGG - Intronic
969380658 4:6794945-6794967 AAGAGAAAGAAGCAGGGTAGAGG + Intronic
970202384 4:13623132-13623154 TATGGAAAAAAGCAAGATGAGGG - Intronic
970429250 4:15973546-15973568 TGGAGAAAAAAACACCATGGGGG - Intronic
971072986 4:23115565-23115587 TAAAGAAAAAAACATGAGGGTGG + Intergenic
971158106 4:24104680-24104702 TAAAGACAAAAGCAGGAATGGGG + Intergenic
971225072 4:24744217-24744239 TAGAGATAAAACCAGGCCGGAGG - Intergenic
971655249 4:29336003-29336025 TAGAAGAAAAAGGAGGAAGGAGG - Intergenic
971663593 4:29453212-29453234 TAAAGAATAAAGCAGGGTAGTGG + Intergenic
972065005 4:34931123-34931145 TAGAGAAAAGAGTAGAATGGTGG + Intergenic
972556753 4:40189219-40189241 TGAAGAAGAAAGCAGCATGGTGG + Intergenic
972640245 4:40918737-40918759 CAGAGAAAAAATAAGGAAGGAGG - Intronic
973051233 4:45600706-45600728 TAGAGACAAAAGCAAGTTAGAGG + Intergenic
973083345 4:46023481-46023503 TAGAGAAAAATGAATTATGGAGG + Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974439468 4:61898177-61898199 TAGGGCAGAAGGCAGGATGGAGG + Intronic
974861030 4:67521896-67521918 GACAGAAAAAAGTAGAATGGTGG + Intronic
975146371 4:70971930-70971952 TAGAGAAAGAAGAAAGAAGGAGG - Intronic
976212279 4:82683129-82683151 GAGAGAAAACAGGAGCATGGCGG + Intronic
976242679 4:82974882-82974904 TAGATACAAAAGTGGGATGGTGG + Intronic
976306137 4:83561129-83561151 TAGAGAAAACAGCACAATGGGGG + Intronic
976331307 4:83833786-83833808 TAGAGAAAGGAGCGGGGTGGCGG + Intergenic
976451401 4:85195499-85195521 AACAGAACAAAGCTGGATGGAGG - Intergenic
976509726 4:85894131-85894153 AAGAGAAAAATGCAGGTTTGTGG + Intronic
976554210 4:86432095-86432117 TAGAGAAGAAAGCCTAATGGTGG + Intronic
977174183 4:93798951-93798973 CAGAGAAAAAAGCAGGGGGTAGG + Intergenic
977374565 4:96185210-96185232 GAGAGAAAGAAGGAGGATAGGGG - Intergenic
977422772 4:96824125-96824147 TAGAGAGAAAGGAAGGAGGGAGG - Intergenic
977527824 4:98166051-98166073 TAGAGTAAAAAGCAGGCTTTTGG - Intergenic
977545351 4:98370473-98370495 TGGAGAAAAAAGGAGAAAGGAGG - Intronic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
978712946 4:111807655-111807677 AAGAGAAAAAAGCAGGAGGTCGG + Intergenic
978835063 4:113139426-113139448 AAAATAAAAAAGCAAGATGGGGG - Intronic
979092667 4:116505190-116505212 AAGAGAAAAAATCAGTATGGAGG + Intergenic
979247453 4:118525167-118525189 TGGAGAAAAAAGGAGGGTGGTGG + Intergenic
979678909 4:123438112-123438134 TAGAGAAAGAAGCATGATTTTGG - Intergenic
979724568 4:123944977-123944999 AAGAAAAAAAAGCAAGATGCAGG - Intergenic
980034748 4:127871030-127871052 TAGGGAAAACAGCAGGAGTGAGG + Intergenic
980288192 4:130808275-130808297 TACAGAAAGAAGGAGGGTGGAGG + Intergenic
980289230 4:130824359-130824381 TAGAGAAAAGAGAGGGAGGGAGG - Intergenic
980751397 4:137094684-137094706 AAAAGAATAAAGCAGAATGGTGG + Intergenic
981574510 4:146190694-146190716 TGGAGAATAAAGCAGGGTTGTGG - Intronic
982066562 4:151659650-151659672 TGAAGAAAAAGGCAGGACGGAGG - Intronic
982262532 4:153507396-153507418 TAGAGAAAAAGCAAGCATGGGGG - Intronic
982808474 4:159796157-159796179 GAGAGAGAATTGCAGGATGGTGG - Intergenic
982973081 4:162015750-162015772 TAAAGAAAAAAGTAGAAAGGAGG - Intronic
983021539 4:162682866-162682888 AAGAGATAAAAGCAGGATGCTGG - Intergenic
983094922 4:163550312-163550334 AAAAGAAAAAAGCAGGAGGTAGG + Intronic
983318770 4:166167832-166167854 TTGAGAACATAGCAGGATTGAGG + Intergenic
983438526 4:167749872-167749894 GGGAGAAAAAAGGAGGATGCAGG + Intergenic
984529754 4:180901916-180901938 TAGAGAAAGAAGCAGGCTCTTGG - Intergenic
984559057 4:181246937-181246959 CAGAGAGCAAAGGAGGATGGAGG + Intergenic
984602540 4:181745073-181745095 TAGAGAAGAAAGGAAGATCGAGG + Intergenic
984724483 4:183007752-183007774 TAGACACAAAAGTAGAATGGGGG + Intergenic
984930009 4:184838722-184838744 TAAAGAACAAAGCAGGTTGGGGG + Intergenic
985004327 4:185518657-185518679 TGGAGAAAAAAGGATGATGAGGG - Intronic
986184646 5:5423915-5423937 TAGAAAATAAAGGAGGATGTTGG + Intronic
986628947 5:9750313-9750335 TTAAGAAAGCAGCAGGATGGTGG - Intergenic
988095395 5:26601970-26601992 GAGAGAAAAAAGAAGGAAGTGGG - Intergenic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
989597168 5:43167071-43167093 AAGAGAGAAAAGCTGGTTGGTGG + Intronic
990993944 5:61712506-61712528 AAGAGAGCCAAGCAGGATGGAGG - Intronic
991267055 5:64731959-64731981 AAGTGAAGAAAACAGGATGGGGG + Intronic
991541333 5:67732580-67732602 TAGAGAACAGAGGAGGGTGGAGG + Intergenic
992082825 5:73251250-73251272 TGGAGGAATAGGCAGGATGGAGG + Intergenic
992645239 5:78805625-78805647 TAGAAAAACAAGCAGGAAAGAGG + Intronic
992941441 5:81766302-81766324 TGGAGGAAAAAGGAGGAAGGAGG + Intergenic
993535681 5:89083091-89083113 TAGAAGAGAAAGCAGGAAGGGGG - Intergenic
993575780 5:89598570-89598592 TAGAGAAAGATGGAGGATGCAGG - Intergenic
993911375 5:93689065-93689087 TAGAGAAATAAGCAGGAGCCAGG - Intronic
994047044 5:95321818-95321840 AAGAGAAAAAAGCAGCTTGAAGG + Intergenic
995366873 5:111371913-111371935 TAGAGAAAACAGCAGAATTGAGG + Intronic
995533529 5:113113783-113113805 GAGACAAAACAGCAGGAGGGAGG + Intronic
995752551 5:115469512-115469534 TAGAGAAAAAAAAAGGATCTTGG - Intergenic
995824204 5:116275342-116275364 TTGGGAATAAAGCAGGATGGGGG - Intronic
995900038 5:117054863-117054885 CAGAGCAAAATGCAAGATGGGGG - Intergenic
996699613 5:126437181-126437203 TGGAGAACAAAGCAGGAAGCAGG + Intronic
996994670 5:129680813-129680835 AAGAGAAAAAATCAGGATGATGG + Intronic
997596466 5:135110479-135110501 TAAAGAAAGCAGCAGGATGAGGG - Intronic
998270364 5:140700894-140700916 GAGAGAGAAAAGAAAGATGGTGG + Exonic
998901483 5:146860135-146860157 TAAAAGGAAAAGCAGGATGGTGG - Intronic
998955049 5:147430193-147430215 GGAAGAAAAAAGAAGGATGGGGG + Intronic
999208779 5:149869723-149869745 GGAAGAAAAGAGCAGGATGGAGG + Intronic
999881179 5:155866213-155866235 TAGAGAAAAGAGATGGAGGGAGG - Intergenic
1000674923 5:164108861-164108883 TAGAGAATGAAGCAGAATGAAGG + Intergenic
1001400350 5:171442621-171442643 AAGAGAACAAAGCTGGAGGGTGG - Intronic
1001519981 5:172384539-172384561 TAGAGACAGAAGTAGAATGGTGG - Intronic
1001621918 5:173093944-173093966 GAGAGTAAAAAGTAGAATGGAGG - Intronic
1001718723 5:173839091-173839113 TAGAGAACAAATCAGGATTAGGG - Intergenic
1001732160 5:173968567-173968589 TAGAGAAAGAATCAGGAGGTGGG + Intergenic
1003181292 6:3794113-3794135 AAAAGAACAATGCAGGATGGTGG + Intergenic
1003597900 6:7490837-7490859 CAGAAAAAAAAGGCGGATGGGGG - Intergenic
1003752503 6:9075509-9075531 GAGAGAAAAAAACGGGAGGGAGG - Intergenic
1003752825 6:9080561-9080583 TGGAGAAAGAAGCAGGAAGTGGG - Intergenic
1004686244 6:17948098-17948120 AATAGAAAAAAGTAGGATAGAGG - Intronic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1005603270 6:27448872-27448894 TAGATAATAAAGCAGGGTGAAGG - Intergenic
1005721578 6:28607559-28607581 TAGAGCAAAGAACAGCATGGAGG + Intronic
1006573777 6:35027771-35027793 TGGAGAAGAAAGCAGGATAAAGG - Intronic
1007166816 6:39834305-39834327 GAGTGAAAAAAGAAGGATGTAGG - Intronic
1007287369 6:40757363-40757385 CAGAGAGAGAAGCAGGTTGGTGG + Intergenic
1007632366 6:43279571-43279593 TAGAGAAAATGGCTGGATAGAGG - Intronic
1007681122 6:43634192-43634214 AAGAAAAAAAAAAAGGATGGAGG - Intronic
1008071135 6:47100304-47100326 CAGAGAACAAAGGAAGATGGAGG - Intergenic
1008167721 6:48160064-48160086 AAGAGAAAAAAATAGGATGCAGG - Intergenic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1008521691 6:52367729-52367751 TAGAGGAAAGATGAGGATGGAGG + Intronic
1008560366 6:52718745-52718767 TTGAGTAGAAAGCAGAATGGAGG - Intergenic
1008752115 6:54747504-54747526 AAGAGAAAAAAAAAGGATGAAGG - Intergenic
1009440937 6:63677287-63677309 TAGATAAAGAAGAAAGATGGGGG + Intronic
1010570153 6:77465090-77465112 TCAAGAAAAAAGGGGGATGGTGG + Intergenic
1010676670 6:78753718-78753740 TAGAGCAAAAAGCAGGCTCTTGG + Intergenic
1012289079 6:97428718-97428740 TAGGAATAAAAGCAGGCTGGAGG + Intergenic
1012311685 6:97733200-97733222 GAGAGAAAAAAGTAGAATGAAGG + Intergenic
1012995950 6:105974861-105974883 TGGAGAAAAAAGCAACAAGGGGG - Intergenic
1013155394 6:107488448-107488470 AAGAGAAGAAATCAGGAGGGAGG + Intergenic
1013327612 6:109063271-109063293 AAGAGAAATAAGTAGGAGGGTGG + Intronic
1013697690 6:112723616-112723638 TTGAGCAAAAAGTTGGATGGAGG + Intergenic
1014215962 6:118753002-118753024 GAGAGAGAAAAGAAGGATTGAGG - Intergenic
1014810821 6:125883677-125883699 TAGGGGAAAGAGAAGGATGGGGG - Intronic
1015035615 6:128650799-128650821 TAGATAAAAGATGAGGATGGTGG + Intergenic
1015187131 6:130430564-130430586 TAGAAAAAAAAGGAAGATGGTGG - Intronic
1015618478 6:135104677-135104699 TGTAGAAAAAAGCTGGATGGGGG - Intergenic
1015646830 6:135400870-135400892 AAGGGAAAAAAACAGGCTGGAGG - Intronic
1016297281 6:142586876-142586898 TAGAGAAGAAAGCCTAATGGTGG - Intergenic
1016447116 6:144145763-144145785 AAGAAAAAAAAGTAGAATGGTGG + Intergenic
1016537985 6:145130048-145130070 TAAAGAAAAAAAAAGGCTGGAGG - Intergenic
1016540161 6:145155816-145155838 AATAGAGAAAAGCAGGCTGGAGG - Intergenic
1016828189 6:148407262-148407284 TACAGACAAAAGTAGAATGGTGG - Intronic
1017586940 6:155936878-155936900 TAGAGAGAGAAGGAGGAGGGAGG + Intergenic
1017656245 6:156632721-156632743 TAATGAAAAAATAAGGATGGAGG - Intergenic
1017971753 6:159317822-159317844 AAGGGGCAAAAGCAGGATGGAGG + Intergenic
1018008631 6:159647677-159647699 GAGAGAAGGAAGAAGGATGGAGG + Intergenic
1018424531 6:163668377-163668399 TAGAGAAATTAGCAGGATTCTGG + Intergenic
1018556166 6:165052560-165052582 GAAAGAAAAAAGCTGAATGGAGG - Intergenic
1018581796 6:165314287-165314309 AAGAGAAAAAAGCAAGGTGGAGG - Intergenic
1018920672 6:168170350-168170372 TAAAGGAAAAATGAGGATGGAGG - Intergenic
1019507584 7:1400348-1400370 TAGAGACAGAAGTAGGAAGGTGG - Intergenic
1020080034 7:5282229-5282251 GGGAGAAAAGAGGAGGATGGAGG + Intronic
1020403945 7:7810023-7810045 TATAGAAAAAAGGAGACTGGAGG + Intronic
1020695216 7:11405739-11405761 AAGACAAAATAGCAGTATGGAGG - Intronic
1021159541 7:17255140-17255162 TGAAGGAAAAAGCAGAATGGAGG + Intergenic
1021601834 7:22372145-22372167 AAGAAAAAAATGCAGAATGGTGG + Intergenic
1022018977 7:26380251-26380273 TTAAAAAAAAAACAGGATGGAGG + Intergenic
1022128414 7:27379843-27379865 ATGAGAACAAAACAGGATGGGGG - Intergenic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1022817658 7:33928958-33928980 TAAAGAAAAAGGCAGGGGGGTGG - Intronic
1023575188 7:41619748-41619770 AAGAGAAGAAACCAGGAAGGAGG - Intergenic
1023908721 7:44539445-44539467 CAGGGACAAAAGCAAGATGGTGG - Exonic
1023948649 7:44823622-44823644 TAGAGAAAAAGGGAGGGAGGTGG - Intronic
1024037810 7:45523673-45523695 CAGAGCAAGAGGCAGGATGGTGG + Intergenic
1024076886 7:45825628-45825650 AAGGGAAAAAAGCAGCATGCAGG - Intergenic
1024610465 7:51059750-51059772 TAGTGCAAACAGCAGGATGAGGG - Intronic
1024855763 7:53777050-53777072 TAGAGACAGAAGCAGAATGGAGG - Intergenic
1024871684 7:53970640-53970662 TAGAACAAAAAGCAGGAGGAAGG - Intergenic
1025198882 7:56949987-56950009 GGGAGAAAAGAGGAGGATGGAGG - Intergenic
1025481393 7:60988141-60988163 AAAAGAAAAAAGGAGGAGGGGGG - Intergenic
1025673064 7:63626946-63626968 GGGAGAAAAGAGGAGGATGGAGG + Intergenic
1026131836 7:67627380-67627402 TTGAGAAAACAGAAGTATGGAGG + Intergenic
1026445698 7:70482783-70482805 TAGAGAAAGCAGCAGGAATGGGG - Intronic
1028262784 7:88685651-88685673 GAAAGAAAGAAGGAGGATGGAGG - Intergenic
1028433114 7:90771100-90771122 TATAGACAGAAGCAGGCTGGGGG - Intronic
1028599237 7:92583271-92583293 TAGAAAAGAAAGTAGAATGGAGG + Intronic
1029107403 7:98189621-98189643 TAGACACAAATGCGGGATGGAGG + Intronic
1029353755 7:100034614-100034636 TTGAGAAATAAGCAGGATGTTGG - Exonic
1029584867 7:101463841-101463863 AAGAGAAAAAAGAGGGAGGGAGG - Intronic
1029678165 7:102087052-102087074 TGGATAAAAAAGCAAGATGTAGG - Intronic
1029907559 7:104106856-104106878 TAGAAAAAAATGCAGGGTTGAGG - Intergenic
1030396532 7:108993671-108993693 AAGAGAGAAAACCAGGAGGGAGG - Intergenic
1030447725 7:109668292-109668314 TGGTGAGAAAAGCAGGATGGTGG + Intergenic
1030462198 7:109853615-109853637 TAGAGAATAAATGAGGATGTGGG - Intergenic
1031142225 7:117956031-117956053 TGGAGAAAGAAGGAGGATGAGGG + Intergenic
1031169842 7:118279183-118279205 TAGGGTAAAAAGGAGGCTGGTGG + Intergenic
1031260090 7:119507306-119507328 TAGAGAAACAAGTAGGTTGATGG + Intergenic
1031527788 7:122842273-122842295 TAGAGCAGAAAGCAGGACGGAGG + Intronic
1031981835 7:128132638-128132660 GAAATAAAAAGGCAGGATGGAGG + Intergenic
1032089557 7:128904416-128904438 GAGAGAAAGAGGGAGGATGGTGG - Intronic
1032272158 7:130419267-130419289 TGGGGAAAAAAGGAGAATGGAGG + Intronic
1032605242 7:133343702-133343724 TAAAGAAATAGGCAGGATGAGGG - Intronic
1032680203 7:134174667-134174689 CAGAGAAGAAAGTGGGATGGTGG + Intronic
1033641364 7:143265230-143265252 AAGAGAAGACAGCAGGAAGGCGG - Exonic
1034026452 7:147709316-147709338 TAAAGAAAAAAGTAAGATGCGGG - Intronic
1034310522 7:150083786-150083808 GAGAGAAAACAGCAGTATGGAGG - Intergenic
1034328708 7:150263086-150263108 TAGAGAAAACAGTAGGAAGTCGG + Intronic
1034457233 7:151177437-151177459 CAGAGAGGAGAGCAGGATGGTGG - Intronic
1034492380 7:151400320-151400342 AAGGGAAGAAAGCAGGATGTAGG + Intronic
1034764508 7:153706299-153706321 TAGAGAAAACAGTAGGAAGTCGG - Intergenic
1034796317 7:154016844-154016866 GAGAGAAAACAGCACTATGGAGG + Intronic
1036086238 8:5616244-5616266 AAGACAGAAATGCAGGATGGAGG + Intergenic
1036306946 8:7609982-7610004 TAGGGAGAACAGCAGGATAGGGG + Intergenic
1036722319 8:11188017-11188039 TAGAAAAAAAAACAGGATTAAGG - Intronic
1036893153 8:12608976-12608998 TAGGGAGAACAGCAGGATAGGGG - Intergenic
1037638470 8:20721524-20721546 AAAAGCAGAAAGCAGGATGGAGG - Intergenic
1037933108 8:22895710-22895732 AAGAGAGAAAAGAAGGCTGGGGG - Intronic
1038125028 8:24664046-24664068 GAGAGAAAAAAACAAGTTGGAGG + Intergenic
1038339334 8:26671277-26671299 TAGGGAAAAAGTCAGGCTGGTGG - Intergenic
1038432138 8:27508935-27508957 AAAAAAAAAAAGCAGGATGGGGG - Intronic
1038432153 8:27509056-27509078 TAGAGAAAAAAGCAGGATGGGGG - Intronic
1038569815 8:28651262-28651284 TAGTGCAAACAGCAGCATGGTGG - Intronic
1038788796 8:30648176-30648198 GAGAGAATAAAGCATGTTGGAGG + Intronic
1039235407 8:35497395-35497417 TTGAGAAAACAGCAGTAGGGAGG - Intronic
1039514309 8:38119311-38119333 AAGCGCAAACAGCAGGATGGAGG + Exonic
1039787534 8:40847050-40847072 TAGAAAAACTAGCAGTATGGTGG + Intronic
1040002629 8:42592000-42592022 AAGAGAATAAAGCAGGAAGCTGG - Intergenic
1041453371 8:58031841-58031863 GAGAGAAGAAAGAAGGAAGGAGG - Intronic
1041691395 8:60691486-60691508 CAGTGAGAAAAGGAGGATGGGGG - Intronic
1041985413 8:63916741-63916763 GAGAGAAAAAAGAAAGATGTAGG - Intergenic
1042893723 8:73642703-73642725 TAGAGAAAAAAGCAAGGCAGGGG + Intronic
1043600341 8:81929450-81929472 TAGAGAAACAAGCAGGCTTTTGG + Intergenic
1043683486 8:83060759-83060781 TAGAGATTAAAGTAGAATGGTGG - Intergenic
1044471112 8:92569167-92569189 TAAAGGAGAAAGCAGGGTGGTGG - Intergenic
1044769332 8:95613539-95613561 TAGAGAAAAAAGTACAATGCTGG - Intergenic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1044998113 8:97856244-97856266 TAGAGTAAAAAATAGGAAGGGGG - Intergenic
1045441872 8:102221868-102221890 TAGAGAAAAAAGAAGGGAAGAGG - Intronic
1045621227 8:103980604-103980626 TAGAGCAAAAAGCAGGCTCATGG + Intronic
1045653143 8:104361496-104361518 TAGATAAATTAGCAGGATGTGGG - Intronic
1045961571 8:107974707-107974729 GAGAGGAAAAAGCAGGGAGGGGG + Intronic
1045997859 8:108384426-108384448 TATAGAACAAACCAGAATGGAGG - Intronic
1046161366 8:110370146-110370168 GAGAGAAAAAAAAAAGATGGAGG - Intergenic
1046809848 8:118521211-118521233 TAGAGATAACAGCTGGATGATGG - Intronic
1047192636 8:122692133-122692155 TAGAGAAAGAAACAGGATCAAGG + Intergenic
1047324625 8:123824601-123824623 TGGAGGAAGAGGCAGGATGGGGG - Intergenic
1047380236 8:124355027-124355049 AAAAGAAAAAAGTATGATGGAGG + Intronic
1047632303 8:126721632-126721654 TGGGGAAAAAAGATGGATGGTGG - Intergenic
1048376950 8:133831245-133831267 TAGAGGAAAAAGAAAGAAGGGGG + Intergenic
1048700945 8:137088978-137089000 TAGAGAAGAAACCAGTATGCTGG + Intergenic
1049226102 8:141451255-141451277 GAGAGAAAAAAGCAGCGTGGGGG + Intergenic
1049739881 8:144233530-144233552 TAGAGAGAGAAGGTGGATGGTGG - Intronic
1050149701 9:2607239-2607261 TAAGGAAGAAAGCAGGATAGAGG - Intergenic
1050758706 9:9039489-9039511 TATTTACAAAAGCAGGATGGTGG - Intronic
1050870579 9:10563993-10564015 GAGAGAAAAAAAGAGGATGTAGG - Intronic
1050957443 9:11682443-11682465 GAAAGAAAAAAGAAGGAAGGAGG + Intergenic
1051306179 9:15712342-15712364 TAGAAAAGAAAGTAGAATGGAGG - Intronic
1051398954 9:16658830-16658852 AAGAGAAAAAAGTTGGGTGGGGG - Intronic
1051791790 9:20813049-20813071 TAGAGCAGAAAGTAGAATGGTGG - Intronic
1051872266 9:21752067-21752089 TAGAGAACACTGGAGGATGGGGG + Intergenic
1052777286 9:32744904-32744926 TAGAGTAGAGAGCAGAATGGTGG + Intergenic
1055274081 9:74594569-74594591 GAGAGAAAAAAGCAGAAAGTTGG + Intronic
1055303956 9:74909728-74909750 TACAGACAAAAGCAGTATGTGGG - Intergenic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055989510 9:82090580-82090602 TAGAGGAAAAAACAGGAAGAAGG - Intergenic
1056147578 9:83748485-83748507 TTTAGAAACAAACAGGATGGAGG + Intronic
1056414564 9:86364011-86364033 TGGGGAAAAAAAAAGGATGGGGG - Intergenic
1056813654 9:89783598-89783620 TAGAGAAGAGAGGAGGCTGGAGG + Intergenic
1057253904 9:93527565-93527587 TAAAGAAAAAAGGGGGGTGGGGG - Intronic
1057570064 9:96197668-96197690 TAAAGAAAAAAGTGGGGTGGGGG + Intergenic
1058276765 9:103052131-103052153 TAGAAACAAAAGCAGGCTGTTGG + Intergenic
1058309095 9:103478588-103478610 TAGGAAAAAAAGAAGGAAGGAGG - Intergenic
1058329087 9:103736606-103736628 TAGAGAAAAAAGCTGGAAATAGG - Intergenic
1058884200 9:109310996-109311018 TAGACAAAAAAGTAGAATGGTGG + Intronic
1059919233 9:119139037-119139059 TAGAAAAAAAATCAGTCTGGTGG + Intergenic
1059974580 9:119701959-119701981 TGGAGAAAAAAATAGGGTGGTGG + Intergenic
1059993701 9:119889192-119889214 TTGAGACAATAGCAGGGTGGTGG + Intergenic
1060723685 9:125994203-125994225 CAGAGCTAAGAGCAGGATGGAGG - Intergenic
1060997193 9:127881403-127881425 TAGAAAAAAAAGTAGAATGGTGG + Intergenic
1061281933 9:129602549-129602571 AAGAGAAGAAAGCGGGAAGGAGG + Intergenic
1061546684 9:131308578-131308600 AACAGCAAAAATCAGGATGGTGG + Exonic
1061673851 9:132204294-132204316 TTGAGGAAAAAACAGGTTGGGGG - Intronic
1062689966 9:137836591-137836613 TGGAGAACATAGCAGGCTGGAGG - Intronic
1203434793 Un_GL000195v1:128893-128915 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1185545400 X:939789-939811 AAGAGAAAAGAGGAGGAGGGGGG - Intergenic
1185712814 X:2317594-2317616 AAGGGAAAAAAGCAGGCAGGAGG + Intronic
1185731688 X:2466776-2466798 AAGTGAAAAAAGTAGGCTGGGGG + Intronic
1185766839 X:2732498-2732520 AAGAGAGAAAAGAAGGAGGGAGG - Intronic
1185818855 X:3182532-3182554 TAAGGAAAAAAAAAGGATGGGGG + Intergenic
1186239522 X:7551491-7551513 GAGAGAAAAAAGCAATATGAAGG - Intergenic
1186643782 X:11484502-11484524 AAGAGAAAAAAGGAAGAAGGAGG + Intronic
1186846093 X:13532501-13532523 TAGGGAAAAAAGCTAGATGCAGG + Intergenic
1186908025 X:14132201-14132223 AAGAGGAAAAGGCAGGTTGGGGG + Intergenic
1187615936 X:20992992-20993014 TAAAGAAGAAAGTAGTATGGTGG + Intergenic
1187652056 X:21420369-21420391 TAGAGAACAAAGCAGGTTCTTGG - Intronic
1188220047 X:27530360-27530382 TATAGAAAACAGAAGAATGGCGG - Intergenic
1188239949 X:27773796-27773818 CAGTGAATGAAGCAGGATGGGGG - Intergenic
1188251094 X:27895892-27895914 GAGACAAAAAAGTAGAATGGTGG - Intergenic
1188380618 X:29487334-29487356 TAGAGATGAAAGAAGGTTGGGGG - Intronic
1189262023 X:39686180-39686202 AAGAAAAAAAAGAAGGAAGGAGG + Intergenic
1190250673 X:48722223-48722245 TAAAGGCAAAAGCAGAATGGAGG + Intergenic
1190827119 X:54027920-54027942 TAGAAAAAAAAACAGGAAGGGGG + Intronic
1190963944 X:55280113-55280135 GAGAGAAAGAATCAAGATGGTGG - Intronic
1191191138 X:57668793-57668815 AAAAAAAAAAAGCAGGGTGGGGG - Intergenic
1191679862 X:63830023-63830045 TAATGAGAAAAGCAGCATGGGGG - Intergenic
1192269714 X:69567182-69567204 TAGAGAGAAAATGAGGAAGGGGG + Intergenic
1192528349 X:71867098-71867120 TTGAGAGAAAAGCAAGAGGGAGG + Intergenic
1192884156 X:75319654-75319676 ATGAGAAAAAAACAGCATGGGGG - Intergenic
1194122057 X:89974204-89974226 TAAAAAAAAAAGCAAGATGATGG + Intergenic
1194526484 X:94983686-94983708 TAGAGCAACAAGCAGGATCTTGG + Intergenic
1194656091 X:96575677-96575699 TAGAGAAAAAACCCAGATGTAGG + Intergenic
1195421766 X:104683455-104683477 CAGAGAAAGAAGCAGAATGACGG + Intronic
1195493604 X:105503457-105503479 AAGAGAAAAAAGAAGGAAGCTGG + Intronic
1195515625 X:105772226-105772248 GAGAGAAATAGGCAGGATGTGGG + Intergenic
1196550214 X:117015588-117015610 TAGAGACAAAAGTAGAATAGTGG + Intergenic
1197299891 X:124765139-124765161 TATAGAAAAAAGCAGACAGGAGG + Intronic
1197894855 X:131301977-131301999 CAATGAAAATAGCAGGATGGGGG + Intronic
1197920262 X:131584725-131584747 AAAAAAAAAAAGCAGAATGGAGG + Intergenic
1198073055 X:133168675-133168697 GAGAGACCAAAGCAGCATGGAGG - Intergenic
1198293031 X:135257198-135257220 TAGAGCAAGAAGCAGGCTGTTGG + Intronic
1199138887 X:144287116-144287138 TAGAGAAACAAGCAGGCTCTTGG - Intergenic
1199185341 X:144909755-144909777 TACAGAACAAAGCAGGTTGTGGG + Intergenic
1199297485 X:146175553-146175575 TAGAGAAACAATCAGGAGTGAGG + Intergenic
1199334950 X:146607698-146607720 TGGAGAAAAATGCAAGATGCAGG + Intergenic
1200474912 Y:3631640-3631662 TAAAAAAAAAAGCAAGATGATGG + Intergenic
1201462390 Y:14240420-14240442 AAGGGAACAAAACAGGATGGAGG + Intergenic
1201697034 Y:16837416-16837438 TGGAGAAAAAAGGTGAATGGGGG - Intergenic
1201697524 Y:16842091-16842113 TTAAGAAAAAGGCAAGATGGGGG + Intergenic
1202088931 Y:21168303-21168325 GAGAGAAAAAAGCAGTATATTGG + Intergenic
1202273791 Y:23095504-23095526 TAGAGACAGAATCAGGATTGGGG + Intergenic
1202292235 Y:23325173-23325195 TAGAGACAGAATCAGGATTGGGG - Intergenic
1202426787 Y:24729249-24729271 TAGAGACAGAATCAGGATTGGGG + Intergenic
1202444004 Y:24940845-24940867 TAGAGACAGAATCAGGATTGGGG - Intergenic
1202597282 Y:26554039-26554061 TGGAGAAACAAGCACTATGGTGG + Intergenic