ID: 1038435634

View in Genome Browser
Species Human (GRCh38)
Location 8:27533952-27533974
Sequence AACCCATGGAAGCCTGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038435634_1038435643 30 Left 1038435634 8:27533952-27533974 CCCTGTCCAGGCTTCCATGGGTT 0: 1
1: 0
2: 1
3: 23
4: 217
Right 1038435643 8:27534005-27534027 CATGAACAGCAGCTGTTTCTGGG No data
1038435634_1038435642 29 Left 1038435634 8:27533952-27533974 CCCTGTCCAGGCTTCCATGGGTT 0: 1
1: 0
2: 1
3: 23
4: 217
Right 1038435642 8:27534004-27534026 TCATGAACAGCAGCTGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038435634 Original CRISPR AACCCATGGAAGCCTGGACA GGG (reversed) Intronic
900992206 1:6103278-6103300 CACCCAGGAAAGCCTGGCCAGGG - Exonic
902329892 1:15726112-15726134 ACGCCCTGGCAGCCTGGACATGG - Intronic
902669993 1:17966560-17966582 AACCAATGGGAGCCCAGACAGGG - Intergenic
902967052 1:20012903-20012925 AACCCTTGGCAGCCTGCACATGG - Intergenic
903182415 1:21611620-21611642 GCCCCATGGAGGCCTGGCCAGGG - Intronic
903264101 1:22146414-22146436 AACTCATGGAATCTTGGCCACGG + Intergenic
903308517 1:22432654-22432676 AAACCATGGAAATCTGAACAGGG - Intergenic
903758498 1:25681324-25681346 AACTCTTGGAAGCCTGCACCTGG - Intronic
904476057 1:30765255-30765277 ACCCCAAGGCAGCCTGGACTCGG - Intergenic
904815019 1:33189388-33189410 AATCCATTGAAGGGTGGACATGG - Intergenic
905313389 1:37065959-37065981 AATCGATGGCAGCCTGGACCGGG - Intergenic
906588780 1:47004133-47004155 AACCAATGGAAACCTGTAAAGGG + Intergenic
907558232 1:55364149-55364171 AACCAAGGGAAGGCTGGGCAGGG + Intergenic
908117306 1:60952767-60952789 AACACCTGGAAGCCTTGGCAAGG - Intronic
912067014 1:105756885-105756907 CACCCATGGAAGCCTGCCAAAGG - Intergenic
912467308 1:109882938-109882960 GACCCAGGGAAGCAGGGACAGGG + Intergenic
913998439 1:143671628-143671650 AACCCATGGACGGCTTGACTAGG - Intergenic
915469274 1:156115869-156115891 AACCCTTAGAACCCAGGACAAGG - Intronic
917931664 1:179826677-179826699 AAATCATAGAATCCTGGACAAGG - Intergenic
917948561 1:180003724-180003746 AACCCATGGAAGACTGGGAGAGG + Intronic
918345838 1:183606472-183606494 AAGCCATGAAAGCATGGATAAGG + Intergenic
919158428 1:193798240-193798262 AAGTCATGGAGGCCAGGACAAGG - Intergenic
923018609 1:230145966-230145988 AGCCCAAAGCAGCCTGGACAAGG - Intronic
923420281 1:233807985-233808007 ATACTCTGGAAGCCTGGACAAGG - Intergenic
924165365 1:241275975-241275997 AACCCACGCAAGCCTGTATAAGG - Intronic
924578384 1:245301253-245301275 AACCCAGAGCAGCCTGGCCAGGG - Intronic
1064272461 10:13877892-13877914 TCCCCATGTAAGCCTGGGCATGG + Intronic
1064886022 10:20113511-20113533 AACCCATGGAAGGATGGAATTGG - Intronic
1067573264 10:47386927-47386949 AAGCCTTGGAAGCTTGCACATGG - Intergenic
1070581053 10:77719819-77719841 ACCCCATTGTAGCTTGGACAGGG - Intergenic
1071154463 10:82673039-82673061 AACCCATGAAGGGCTGGGCACGG - Intronic
1074434893 10:113425617-113425639 GACCCATGGAAGGCAGGAGAAGG + Intergenic
1074895424 10:117773264-117773286 TTCCCATGGAAGCATGGGCACGG - Intergenic
1076022901 10:127089132-127089154 TACACATGGAGCCCTGGACACGG + Intronic
1076104671 10:127811954-127811976 AGCCCATGGAACCCTGAACATGG - Intergenic
1076208854 10:128624874-128624896 AGCCCATGGAAGCTGGGGCATGG - Intergenic
1077021190 11:417792-417814 AGCCCATGGAAAACTGGAGAAGG + Intergenic
1077100808 11:821536-821558 ATGCCATGGAACCCTGGACATGG + Intronic
1078431849 11:11294181-11294203 AACCCTTGGAAACTTGGACCTGG - Intronic
1079502023 11:21111609-21111631 AACCCATGGAAGCAAAGACATGG - Intronic
1080462665 11:32469143-32469165 AACCCATTGCTGGCTGGACATGG - Intergenic
1082893398 11:58164133-58164155 AACCCCTGCAAGCCGAGACAAGG - Intronic
1083041861 11:59696090-59696112 GACCCATGGATGCCAGGAGAGGG - Intergenic
1083326001 11:61873337-61873359 AGCCCAGGGATGCCTGGACTCGG - Intergenic
1084461862 11:69300657-69300679 AACCCTAGGAAGCCTTGACAGGG - Intronic
1084967003 11:72750216-72750238 AACCCTTGGGGGCCTGGACCGGG - Intronic
1085289926 11:75390602-75390624 GACCCAGGAAAGCCTGGAGATGG - Intergenic
1089604996 11:119636564-119636586 AACACAGGGAAGCCTGGGCAGGG - Intronic
1089633023 11:119795119-119795141 AACCCATGGGACCCTGGAAAGGG + Intergenic
1090237301 11:125158769-125158791 ACCCCATGTAACCCTGGGCAGGG + Intergenic
1092003228 12:5048161-5048183 GACACATGGAAGCCTGGACATGG - Intergenic
1092944559 12:13440672-13440694 AACCCAAACAAGCCTGGAAAAGG + Intergenic
1093862773 12:24187840-24187862 AAGCCACGGAAGACTGCACAAGG - Intergenic
1093925808 12:24907264-24907286 AACCCACTGTAGCCTAGACAGGG - Intronic
1095244576 12:39904112-39904134 AACCCTTGGAAGCTTGGGCTTGG - Intronic
1096204549 12:49709872-49709894 AACCAATAGAAGTATGGACAGGG + Intronic
1096611962 12:52807935-52807957 AACCCAAGGAAAGCTGGACCAGG - Intronic
1099890807 12:88586408-88586430 AACCCATGAGAGCATGCACAGGG - Intergenic
1100458130 12:94772466-94772488 GATTCATGGAAGCCTGGGCAGGG + Intergenic
1102036221 12:109771893-109771915 AACCCGGGGGAGCCTGGACGGGG + Intergenic
1109388304 13:61662262-61662284 CACTCATGGAAGCCTGGAAATGG + Intergenic
1109983551 13:69944359-69944381 AACCCTTGGAAGTCTGTACCTGG + Intronic
1110030251 13:70602648-70602670 AAACCCTGGAAGGCTGGGCACGG + Intergenic
1110589444 13:77238300-77238322 CTCCCATGTAAGCCAGGACATGG + Intronic
1115460443 14:33654119-33654141 AACCCATGGAAGAATAAACAAGG - Intronic
1116991034 14:51276763-51276785 AACCAATGGAAGCATCTACAGGG - Intergenic
1117339678 14:54782620-54782642 AACCCATCGATGCCGGAACATGG + Intronic
1117742541 14:58833731-58833753 AACCCATGGTACCCTGGAGGTGG + Intergenic
1118616991 14:67580733-67580755 AACAGAGGGAACCCTGGACAGGG - Intronic
1119743786 14:77030101-77030123 ATCCCAGGGAAGGCTGGAGAAGG + Intergenic
1121174515 14:91880839-91880861 AACACATGCAAGGCTGGGCACGG - Intronic
1121338831 14:93093119-93093141 AGCCCATGCAGGCCTGGACTTGG - Intronic
1122104443 14:99441608-99441630 AACCCAGGGAAGCCTGCAGCAGG + Intronic
1122640425 14:103156185-103156207 ACCCCATGCAGGCCTGGGCAGGG + Intergenic
1125512830 15:40302099-40302121 AGCCCCTGGAAGCCTGGGGAGGG + Intronic
1127082442 15:55393858-55393880 AACCAATGGAAGCCTCTAGAGGG + Intronic
1127695341 15:61441380-61441402 TACCCATAGCAGCCTGGAGAGGG - Intergenic
1128145118 15:65328745-65328767 AACCCAAGGCAGCCTTGACAGGG - Exonic
1131154331 15:90065460-90065482 AGTCCTTGGAAGCCTGGAGAGGG + Intronic
1133202086 16:4209901-4209923 ATGGCATGGAAGCCTGGACAGGG - Intronic
1137283005 16:46993836-46993858 AACCAATGGAAACCTGTAGAGGG + Intergenic
1138493820 16:57394703-57394725 ATCCCCAGGAAGCCTGGACTGGG + Intergenic
1139648826 16:68351548-68351570 AGCCCAAGGCAGCCAGGACAGGG - Intronic
1140549307 16:75846733-75846755 GAGCCAGGGAAGGCTGGACATGG + Intergenic
1140981862 16:80117979-80118001 ATCCCATGCCAGCCTGCACATGG - Intergenic
1141425707 16:83943238-83943260 AAGGAATGGAAGCCTGGGCAAGG + Intronic
1141716765 16:85731404-85731426 AACCCAGGGAGGCCTGGAGCTGG + Intronic
1142260656 16:89041126-89041148 AGCCCAGGGAGGCCTGGGCAAGG + Intergenic
1144856921 17:18274375-18274397 AGCCCTGGGCAGCCTGGACAGGG + Exonic
1144956547 17:19021582-19021604 AACCTAAGGAACCCTGGCCATGG - Exonic
1148210667 17:45806664-45806686 TCCCCATGGAATCCTGAACATGG - Intronic
1149321162 17:55482430-55482452 AGCCTGTGGAAGCCTGGAGAAGG - Intergenic
1149894075 17:60415409-60415431 AACCCATGGAAGCCTTCAAATGG - Intronic
1152979451 18:262037-262059 AAACCATGGAAGGATGAACATGG - Intronic
1153278869 18:3395334-3395356 CACCCATGGAGGCCTGGAGCTGG + Intergenic
1154026753 18:10715018-10715040 TACCCATGCATGCCTGGATAAGG + Intronic
1154502352 18:15003147-15003169 AACCCATGGCAGCCTGGGCCGGG + Intergenic
1155485765 18:26340375-26340397 AACTCATGGAGTACTGGACAGGG + Intronic
1156480783 18:37435069-37435091 AACCCAGGGAAGCCCAGACAGGG - Intronic
1156594238 18:38528593-38528615 AACCCAAAGAAGGCTGGGCATGG + Intergenic
1157151551 18:45223606-45223628 TAGCCATGGAAGCCTAGCCAGGG - Intronic
1157568113 18:48693741-48693763 AACCAATGGAGGGCTGGACTTGG - Intronic
1160238990 18:77109120-77109142 CACCCAGGGAACCCTGGACCTGG - Intronic
1163841386 19:19612903-19612925 AACCGATTGAACCCTGGAGACGG - Intronic
1163871054 19:19821600-19821622 ACCCCCTGGAAGCCTAGAAATGG - Exonic
1163875706 19:19865978-19866000 GACCCCTGGAAGCCTAGAAATGG + Exonic
1163878952 19:19901070-19901092 GACCCCTGGAAGCCTAGAAATGG + Exonic
1163948852 19:20565637-20565659 AGCCCCTGGAAGCCTAGAAATGG - Exonic
1163969234 19:20776429-20776451 ACCCCCTGGAAGCCTAGAAATGG + Exonic
1163983447 19:20923382-20923404 ACCCCCTGGAAGCCTAGAAATGG + Exonic
1163993386 19:21020782-21020804 AACCCCTGGAAGCCTAGAAATGG + Exonic
1164030257 19:21397246-21397268 ACCCCCTGAAAGCCTAGACATGG + Exonic
1164042447 19:21505753-21505775 ACCCCCTGGAAGCCTAGAAATGG + Exonic
1164049155 19:21569103-21569125 ACCCCCTGGAAGCCTAGAAATGG - Intergenic
1164096054 19:22010791-22010813 ACCCCCTGGAAGCCTAGAAATGG - Exonic
1164115549 19:22215631-22215653 ACCCCCTGGAAGCCTAGAAATGG - Intergenic
1164136580 19:22422194-22422216 ACCCCTTGGAAGCCTAGAAATGG - Exonic
1164162175 19:22634453-22634475 ACCCCCTGGAAGCCTAGAAACGG + Exonic
1164241750 19:23395324-23395346 AACCCCTGGAAGCCTAGAAATGG - Exonic
1164254172 19:23512512-23512534 ACCCCCTGGAAGCCTAGAAATGG - Intergenic
1164272700 19:23687030-23687052 ACCCCCTGGAAGCCTAGAAATGG - Exonic
1164874511 19:31674099-31674121 AGACAATGGAAGCCTGGAAAGGG - Intergenic
1165081869 19:33311523-33311545 CGCCCAGGGAAGCATGGACATGG + Intergenic
1165723160 19:38093859-38093881 AACCCCAGAGAGCCTGGACAGGG + Intronic
1165948021 19:39456847-39456869 AATCCATGTAAGGCTGGACGTGG - Intronic
1168202452 19:54826108-54826130 AAGCTATGGAGGCCAGGACAGGG + Intronic
930046528 2:47177176-47177198 AACCCATGTAAATCTGGACACGG + Intergenic
931378123 2:61726404-61726426 AACCCAGAGAGGACTGGACATGG + Intergenic
932332511 2:70905747-70905769 ATCCTTTGGAAGCCCGGACAAGG + Intronic
934768282 2:96892767-96892789 AACTCAGGGAGGCCTGGGCAGGG - Intronic
935242218 2:101188807-101188829 AATCCATGGAAGCTGGGAGAGGG + Intronic
935585675 2:104798075-104798097 TACCAATGGAAGTCTGAACAAGG + Intergenic
936040822 2:109148002-109148024 AATCCATGGTATCATGGACAAGG + Intronic
938164018 2:129010421-129010443 TAGCCGTGGAAGCCTGGCCAGGG + Intergenic
938501526 2:131833319-131833341 AACCCATGGCAGCCTGGGCCGGG + Intergenic
939373652 2:141335251-141335273 AAGCCATGGAAGCCAGAAGATGG + Intronic
939929754 2:148218145-148218167 AAGCCATGCAAGTCTGGTCAAGG - Intronic
940216208 2:151306312-151306334 AACATGTGGAAGGCTGGACATGG + Intergenic
942461148 2:176169703-176169725 GACCCAAGGAAGCCTAGTCAGGG + Intronic
945820026 2:214652381-214652403 GACACATGGGAGCCTGGACGTGG - Intergenic
946155939 2:217806650-217806672 GACCCTATGAAGCCTGGACAAGG + Intronic
948909216 2:240994590-240994612 AACCCCTGGATGCCTGCAAAGGG - Intergenic
1169763305 20:9120716-9120738 AACCCATGGAAGACTGCAGCAGG - Intronic
1171293367 20:23995183-23995205 GACAGATGGAAGCCAGGACAGGG + Intergenic
1172289634 20:33766819-33766841 AAGCCAGGGAAGTCAGGACAAGG - Intronic
1175376465 20:58528567-58528589 AACCCATGGGAGGCTGGATGTGG - Intergenic
1175867394 20:62186817-62186839 ATCCCAGGGAAGGCTGGGCACGG - Intronic
1176957875 21:15127099-15127121 GACCCCTGGTAGCCTGGGCATGG - Intergenic
1177862794 21:26474341-26474363 AACACATGGTAGGCTGGGCATGG - Intronic
1179367362 21:40771015-40771037 AACACGAGGCAGCCTGGACATGG + Intronic
1180076227 21:45464453-45464475 AACCCATGGGGGGATGGACACGG - Intronic
1180134510 21:45853546-45853568 AACCAATGGAAACCTGCAGAGGG - Intronic
1182335651 22:29581650-29581672 AACCCTTGGTAGGCTGGGCATGG - Intergenic
1182695889 22:32199128-32199150 AGCCCACGGAAACCTGGAGAGGG - Intronic
1183951730 22:41356387-41356409 AACCCAGGAAAGCCTGGAGAAGG + Exonic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
1185337443 22:50276920-50276942 AACCCAGTGATGCCTGGCCAAGG + Intronic
950112315 3:10427174-10427196 ATCCCATGAAATCCTGGACCAGG - Intronic
950766633 3:15277863-15277885 ACCCCCTGGATGCCTGGACATGG + Intronic
954686559 3:52373244-52373266 AGCCTCTGGAAGCCTGGAAAAGG + Intronic
954883614 3:53853067-53853089 AGCCCAGGGAACCCTGGATAAGG + Intronic
956683611 3:71804289-71804311 AACCTATGTAAGGCTGGGCACGG - Intergenic
956702329 3:71969288-71969310 AACCCAAGGCTGCCTGGGCAAGG - Intergenic
957409291 3:79817012-79817034 AGCCAAAGGAAGCCTGGGCATGG - Intergenic
957944838 3:87050877-87050899 AACCCTTTAAAGCATGGACATGG + Intergenic
960327271 3:116313141-116313163 AACCCATGAAGGCCTGGTTATGG + Intronic
961253374 3:125525026-125525048 AAAACATGGAAGCCTCTACAAGG + Intergenic
961902083 3:130222904-130222926 AACTCATGGAAGCTTTGAAATGG - Intergenic
962245529 3:133788344-133788366 AACCAATGGAAACCTTGAGAGGG + Intronic
962485415 3:135837894-135837916 AGCCCATGGAAGCCAGGGAATGG - Intergenic
964937817 3:162114750-162114772 AACCCTTGGAAGCTTGCACATGG - Intergenic
966028435 3:175315251-175315273 CACCCATGAAAACTTGGACAAGG + Intronic
969476233 4:7424007-7424029 GACCCACGGATGCCAGGACACGG - Intronic
972313432 4:37902202-37902224 AACCCAGGGCAGCATGGGCATGG - Exonic
975607959 4:76174662-76174684 AAGCCAGGGAAGCCAGGGCACGG + Intronic
978098773 4:104811786-104811808 AACACATGGAAACCTGGAACAGG - Intergenic
980002749 4:127509628-127509650 AAAGCACGGAAGCCAGGACAGGG + Intergenic
980368427 4:131837134-131837156 AACCCATGGCAGCCTGGCTTTGG - Intergenic
980632789 4:135458319-135458341 CACCCAGGGAAGCCAGCACAGGG - Intergenic
980781192 4:137494516-137494538 AAGCCATTTAAGCCTGGAAATGG - Intergenic
983143792 4:164187606-164187628 AATCTATGGAAGCCTGGCAAGGG + Intronic
984555898 4:181213520-181213542 AACCCTTGGAAGCTTGTACCTGG - Intergenic
985565204 5:612090-612112 CGCCCAGGGAAGCCTTGACAGGG + Intergenic
986168000 5:5292584-5292606 GAGCCATGGAAGGCTGGACTTGG - Intronic
988769411 5:34416229-34416251 AACCCATGGAGTCCTTGAAAGGG - Intergenic
991959876 5:72033992-72034014 GAGCCATGGAGGCCTGGAGATGG - Intergenic
992400815 5:76409535-76409557 AGCCCATGTAAGGCTGGGCATGG - Intronic
994770525 5:103975358-103975380 AACCTATTTAAGGCTGGACATGG + Intergenic
996695676 5:126392345-126392367 AGCCTAAGGAAGCCTGTACATGG - Intronic
996853267 5:127976622-127976644 AACCAATGGAAGCCTCTAGAGGG - Intergenic
997641376 5:135451010-135451032 AACTCAGGGAAGACAGGACAAGG - Intronic
997670150 5:135664183-135664205 AACCCATGGAAGGCTGGGCTGGG + Intergenic
997863836 5:137443675-137443697 AACCCATGGCTGTCTGGAGAGGG - Intronic
997977616 5:138449551-138449573 ATCCCAAGGAGGCCTGGGCATGG - Intergenic
1001154080 5:169257843-169257865 AAAGCATGGAAGGCTGGGCATGG - Intronic
1001552978 5:172617805-172617827 GACACCTGGAAGCCTGGAAATGG + Intergenic
1001952625 5:175826736-175826758 TTCCCAGGGAAGCTTGGACAGGG + Intronic
1003464284 6:6363688-6363710 AGCCAATGGCAGCCTGGCCATGG - Intergenic
1005034304 6:21541713-21541735 AAACCATGGAGGGCTGGGCACGG + Intergenic
1005526985 6:26660443-26660465 AACCCTGGGCAGCCTGGCCAAGG + Intergenic
1007323367 6:41042751-41042773 AGTCCATGGAAGCCAGGAGATGG + Exonic
1008607697 6:53156437-53156459 AGCCCATGGAAGGCAGGAGATGG - Intergenic
1010410297 6:75553918-75553940 AACACAAGGAAGGGTGGACAAGG - Intergenic
1011744972 6:90400428-90400450 AGCCCATGCTACCCTGGACAGGG - Intergenic
1017983225 6:159420930-159420952 AACTCATGGAGGGCTGGAGAAGG + Intergenic
1020174811 7:5873633-5873655 AACCCAAGGATGGCTGGACTCGG - Intergenic
1023014737 7:35955869-35955891 AGCCCATGCTACCCTGGACAGGG + Intergenic
1024585742 7:50840383-50840405 CACCCATGCCAGCCTGCACAAGG - Intergenic
1025217391 7:57070208-57070230 AGCCCATGCTACCCTGGACAGGG - Intergenic
1025628305 7:63243861-63243883 AGCCCATGCTAGCCTGGATAGGG - Intergenic
1025633802 7:63303949-63303971 ACCCCCTGGAAGCCGGGAAATGG - Intergenic
1025648894 7:63444219-63444241 ACCCCCTGGAAGCCGGGAAATGG + Intergenic
1025653959 7:63500257-63500279 AGCCCATGCTACCCTGGACAGGG + Intergenic
1025865100 7:65373979-65374001 ACCCCCTGGAAGCCTAGAAATGG + Exonic
1026434934 7:70387790-70387812 AGCCAATGAAAGCCTGGACCTGG - Intronic
1026620920 7:71949361-71949383 AACCAATGGAAACCTCGAGAGGG + Intronic
1031034589 7:116774430-116774452 AACCTATGGATTCCTGGCCAAGG - Intronic
1031342740 7:120624488-120624510 AACCCATGGTGGGCTGGGCATGG + Intronic
1038182580 8:25242899-25242921 GTGCCATGGAAGCCAGGACATGG + Intronic
1038435634 8:27533952-27533974 AACCCATGGAAGCCTGGACAGGG - Intronic
1041732686 8:61078077-61078099 GACCCAGGGAAGCCTGCACTGGG - Intronic
1041839729 8:62255389-62255411 AACCCATGGAAGCCAGGGAGAGG + Intronic
1046721644 8:117626764-117626786 ATCCCATGGAAGTCTGGATCTGG - Intergenic
1046904598 8:119558924-119558946 AACCCACACAAACCTGGACAGGG + Intronic
1047618518 8:126582976-126582998 ACCCCCTGGAAGCCTAGAAATGG - Intergenic
1049471310 8:142776168-142776190 GACCCATGGGGGCCTGGGCAGGG + Intronic
1049858142 8:144876830-144876852 CAACCATGGAAGCTTGGAAAAGG - Intronic
1051836065 9:21339230-21339252 AACCTAAGTAAGGCTGGACAAGG + Intergenic
1053077736 9:35149181-35149203 ACCCCCTGGAAGCCTAGAAATGG - Intergenic
1055979479 9:81988092-81988114 ACCCCATGAAAGCCAGCACAGGG + Intergenic
1057192912 9:93097126-93097148 ACCCCATGGCAGCCCGGCCAGGG + Intronic
1059820613 9:117968284-117968306 AGCCCATGGAAGGCTGGCCCAGG + Intergenic
1060161424 9:121369126-121369148 AACACAGGGATCCCTGGACAAGG + Intronic
1061649124 9:132032105-132032127 ATGCCATGGGAGCCTGGGCACGG + Intronic
1062498145 9:136841229-136841251 AACCCACGGCAGCCTGGGCCCGG - Intronic
1186507289 X:10103290-10103312 AACCCTTAGCAGCCTGGGCAAGG + Intronic
1194405678 X:93493724-93493746 GACCCCTGGAAGCCTAGAAATGG + Intergenic
1195899343 X:109781194-109781216 AACCAATGGAATCCTGGAGAGGG + Intergenic
1197317187 X:124981621-124981643 AACCCATGGGAGCGTGGACTTGG + Intergenic
1199720011 X:150536724-150536746 CACCCTGGGAAGCCTGGACTGGG - Intergenic
1200957594 Y:8967802-8967824 AATCCATTGAACCCTGGAGATGG - Intergenic
1201329630 Y:12803824-12803846 AAACCATGGATGGGTGGACAGGG + Intronic