ID: 1038435743

View in Genome Browser
Species Human (GRCh38)
Location 8:27534820-27534842
Sequence AGCCTTGAATGTGCTCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038435743_1038435752 27 Left 1038435743 8:27534820-27534842 CCCAGGAGAGCACATTCAAGGCT 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1038435752 8:27534870-27534892 CCCCTTGGTGGTGGGAAAGATGG No data
1038435743_1038435747 12 Left 1038435743 8:27534820-27534842 CCCAGGAGAGCACATTCAAGGCT 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1038435747 8:27534855-27534877 AGAAAAGCAGAGTTACCCCTTGG No data
1038435743_1038435749 18 Left 1038435743 8:27534820-27534842 CCCAGGAGAGCACATTCAAGGCT 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1038435749 8:27534861-27534883 GCAGAGTTACCCCTTGGTGGTGG No data
1038435743_1038435748 15 Left 1038435743 8:27534820-27534842 CCCAGGAGAGCACATTCAAGGCT 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1038435748 8:27534858-27534880 AAAGCAGAGTTACCCCTTGGTGG No data
1038435743_1038435750 19 Left 1038435743 8:27534820-27534842 CCCAGGAGAGCACATTCAAGGCT 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1038435750 8:27534862-27534884 CAGAGTTACCCCTTGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038435743 Original CRISPR AGCCTTGAATGTGCTCTCCT GGG (reversed) Intronic
900484355 1:2914428-2914450 AGCCCTGCATGTGCTCTCCCCGG + Intergenic
904484107 1:30813731-30813753 AGCCTTGAATGTCCTGGACTTGG - Intergenic
904891573 1:33783491-33783513 GGCCTTGCATGGGCTTTCCTGGG - Intronic
908117092 1:60950970-60950992 AGCCTTTAATGTGATCTCGATGG - Intronic
911345719 1:96694359-96694381 AGGCTTGTATGTGGTCACCTGGG + Intergenic
912302743 1:108534687-108534709 AACCTTCCATGTGGTCTCCTTGG + Intergenic
912560958 1:110551195-110551217 ATCCTGAGATGTGCTCTCCTCGG + Intergenic
915079627 1:153343135-153343157 AGCCTTGGGTGTGCACTCCTTGG + Exonic
915919586 1:159964376-159964398 AGCTTTTAATCTGTTCTCCTGGG + Intergenic
917605872 1:176628907-176628929 AGAGTTGAATGTGGACTCCTAGG + Intronic
918691807 1:187489995-187490017 ATCCTTGAATATATTCTCCTAGG - Intergenic
920118715 1:203639497-203639519 AGGGTTAAATGTGCTCTCCAGGG - Intronic
921366309 1:214378021-214378043 AGCATTGAATGGGCTCTCGGTGG - Exonic
1065736338 10:28756173-28756195 AGGTTTCAAGGTGCTCTCCTTGG - Intergenic
1066338949 10:34510255-34510277 AGGCTTGAGTGTGCTCTGATTGG - Intronic
1067853109 10:49768249-49768271 AATCTTGGCTGTGCTCTCCTTGG - Intergenic
1068768588 10:60795000-60795022 AGGCTAGAATGTGCATTCCTGGG + Intergenic
1071617456 10:87088276-87088298 AGATTTGAATCTGCTCTACTTGG + Intronic
1071752952 10:88502301-88502323 AGGGTTGAATGAGTTCTCCTGGG + Intronic
1072218643 10:93309134-93309156 AAACTTGAATGTCCCCTCCTTGG + Intronic
1072835508 10:98707204-98707226 GGCATTGAAAGTCCTCTCCTGGG - Intronic
1073151164 10:101312570-101312592 ACCCTTGAATCTGCTCTCTTAGG + Intergenic
1073328928 10:102658400-102658422 TGCCTTGATTTTGCTCCCCTGGG + Exonic
1074065492 10:110008676-110008698 AGCCCTGAAGGTGCGCTCCAGGG + Intronic
1074324416 10:112434655-112434677 AGCCTTGTATGTGATTACCTAGG + Intronic
1075594530 10:123718772-123718794 AGCCATGCAGGGGCTCTCCTGGG + Intronic
1076114267 10:127884561-127884583 AGCCTTGACTCTGCTTTCCAAGG + Intronic
1078452796 11:11452904-11452926 TGCCTCGAATGGGCCCTCCTGGG - Intronic
1079833083 11:25295696-25295718 AACATTGAACGTGCTTTCCTTGG + Intergenic
1084216903 11:67652345-67652367 AGTCTTGAAGATTCTCTCCTGGG - Intergenic
1085587836 11:77728208-77728230 AGCCTGGAATGTGTTCCCCATGG + Intronic
1086405072 11:86492696-86492718 AGGGTTGAATGTGCTCTCTATGG + Intronic
1089858477 11:121567946-121567968 AGCCGTGAATGTGCCAGCCTGGG - Intronic
1093914609 12:24787706-24787728 AGCCATGAAGGTGCACTGCTTGG + Intergenic
1094267556 12:28575829-28575851 AGCCTTAAACTTGCTTTCCTAGG - Intronic
1096591872 12:52665453-52665475 ACCTTTGAATGTGCTTTTCTAGG + Intergenic
1098188361 12:67922399-67922421 AGCTTTTATTTTGCTCTCCTGGG + Intergenic
1098287044 12:68917829-68917851 AGACTTGAGTGGGCTTTCCTGGG + Intronic
1102725549 12:115061186-115061208 AGGCCTGAATGGGCTCTCCAGGG + Intergenic
1104835938 12:131790582-131790604 AGCCCTGGATGTGAACTCCTAGG - Intronic
1105865496 13:24455059-24455081 CGCCTTGCATGCGCTGTCCTTGG - Exonic
1106326535 13:28696136-28696158 AGCCGTGAATGTGCCAGCCTGGG - Intergenic
1107043241 13:35970631-35970653 AGCCTTTAAGGTGCCATCCTGGG + Intronic
1113104206 13:106755687-106755709 CTCCTGGAATGTGCTCTCCAGGG + Intergenic
1114267148 14:21079534-21079556 AACCTTGATTCTTCTCTCCTGGG + Intronic
1114888232 14:26881845-26881867 AGCCTTGAAAGTGCTCTTGGAGG - Intergenic
1119672237 14:76528517-76528539 AGCCTTGATCTTGATCTCCTGGG + Intergenic
1124702767 15:31931188-31931210 AGCCTTGTCTGTGCCCTCATGGG + Intergenic
1126778761 15:52120536-52120558 AACCTGGAATGTGCTTCCCTGGG + Exonic
1127640932 15:60915160-60915182 AGCCTTGTTTCTGCCCTCCTGGG - Intronic
1127810269 15:62559767-62559789 GGCACTGAAGGTGCTCTCCTGGG + Intronic
1128143561 15:65319042-65319064 AGCCTGGAAGCTGCGCTCCTGGG - Intergenic
1128775997 15:70321071-70321093 AGCCTTTAACGTGCTGTCGTGGG + Intergenic
1130411484 15:83652702-83652724 AGCCTTGAAGATCCTCTTCTTGG + Intergenic
1132075134 15:98813476-98813498 AGCCTTTATTGTGGTTTCCTTGG - Intronic
1133922145 16:10162949-10162971 AGCCTTGGATGTGCCTTCGTGGG - Intronic
1136455178 16:30376235-30376257 AGCCTTGAATATTCCCACCTGGG - Intronic
1139100993 16:63766880-63766902 AGCCTTGATTGTCCTCACCTGGG - Intergenic
1139900455 16:70323950-70323972 TGCCTTGGCTGTGCTCTGCTTGG - Intronic
1140343970 16:74194315-74194337 AGACTGGAAAGTCCTCTCCTGGG - Intergenic
1142159691 16:88550621-88550643 AGCCTGGACTGTCCTCTCCCGGG - Intergenic
1143762459 17:9115364-9115386 AGCCTTGCATGTGTTCCCCAGGG + Intronic
1143921170 17:10332081-10332103 AGCCTTGCCTGTGCTCACCTTGG + Exonic
1144134216 17:12277896-12277918 AGACCTGAATGTGCTCTCTGTGG + Intergenic
1144763847 17:17722499-17722521 GGCCTTGAGTGCGCTCCCCTCGG + Intronic
1149467360 17:56890660-56890682 AGGCTTGACTGTGCTAGCCTCGG + Exonic
1152190949 17:78887018-78887040 AGCCTCGAATTTCCTCTACTTGG + Intronic
1152739544 17:82012885-82012907 AGCAATGAATGTCCTGTCCTTGG + Intronic
1154009120 18:10560342-10560364 AGCCTTGAGGGGGCTTTCCTGGG + Intergenic
1155236015 18:23820007-23820029 AGCCATGAAGCTGCTCTCTTCGG - Intronic
1156652226 18:39238019-39238041 AGACTTGTATTTCCTCTCCTTGG - Intergenic
1157504789 18:48218672-48218694 ATCCTGGACTCTGCTCTCCTTGG + Intronic
1158075985 18:53530436-53530458 AGCCCTGGCTGTGGTCTCCTAGG + Intronic
1160072977 18:75644749-75644771 GGCCTTGAATGTGTCTTCCTGGG - Intergenic
1161166474 19:2790583-2790605 CGCCTTGAGCGTGCTCTCGTAGG - Exonic
1163370697 19:16899714-16899736 ATCCTTGAGCGTCCTCTCCTGGG - Intronic
1163853035 19:19677243-19677265 AGTCTTTAATGAGCTTTCCTGGG - Intronic
1165634620 19:37330374-37330396 ACCCTTGAATGTACCCTCCAGGG + Intronic
926959244 2:18336219-18336241 AGTTTAGAATGTGCTCTCCAGGG - Intronic
927083878 2:19655428-19655450 AGTCTTGAATGGGGTTTCCTGGG - Intergenic
928410022 2:31047702-31047724 TGTCTTGAAAATGCTCTCCTGGG - Intronic
929536113 2:42785006-42785028 AGCCTTGAATGTACACCACTAGG - Intronic
929917869 2:46151247-46151269 ACCCATGGCTGTGCTCTCCTGGG + Intronic
930366304 2:50444115-50444137 TGCCTTGATTGTGCTGTCATTGG - Intronic
931198780 2:60077285-60077307 GGCCTTGCCTGTGCTCTGCTGGG - Intergenic
931700380 2:64904280-64904302 GGGCTTGAATTTGCTCCCCTTGG - Intergenic
932837266 2:75049431-75049453 CTCCTCCAATGTGCTCTCCTAGG - Exonic
932980776 2:76663271-76663293 AGACTTGAATCTGCTCTGATTGG - Intergenic
935316584 2:101840773-101840795 TGCCTTGAACCTGCTCTTCTTGG - Intronic
937844535 2:126565127-126565149 AACCTTGGGTGTGCTCTCCTGGG + Intergenic
939865674 2:147469741-147469763 AGCCTTCAATGTACTCTGCCTGG - Intergenic
947348315 2:229217047-229217069 AGCCTTGAATGTGGACCTCTGGG - Intronic
1172177872 20:32983631-32983653 ATCCGTGAATGGGGTCTCCTGGG + Intergenic
1172437804 20:34942382-34942404 AGCTATGATTGTGCTTTCCTGGG - Intronic
1175094900 20:56533482-56533504 AGCCTTGGGTGTGCTCTGGTAGG - Exonic
1178250071 21:30995232-30995254 AGCTTTGAATCAGCTCTCCAGGG + Intergenic
949313109 3:2722253-2722275 AGCCTAGAATGTGAGCTCCTTGG + Intronic
953010293 3:39018943-39018965 AGCCTTCAAGCTGCCCTCCTAGG + Intergenic
953836946 3:46354657-46354679 TGCCTGAAATGTGCTGTCCTAGG - Intronic
954468621 3:50673680-50673702 AGGCCTGACTGTGCTCCCCTGGG - Intergenic
958070933 3:88610391-88610413 AATCTTGTCTGTGCTCTCCTGGG - Intergenic
959976972 3:112471865-112471887 AGCCTTAAAAGTGCTCTGCATGG + Intronic
960749999 3:120938425-120938447 AGCTGTGAAGTTGCTCTCCTAGG - Intronic
962095303 3:132286691-132286713 AGCCATGATTGTGCTGTTCTTGG - Intergenic
965265459 3:166537247-166537269 AGGCATGAATGTGCTCTGTTGGG + Intergenic
965852399 3:173044517-173044539 ATCCTTGAATGTACTTTCATAGG + Intronic
966614551 3:181899291-181899313 GGCCTTTAACATGCTCTCCTAGG + Intergenic
966787177 3:183632262-183632284 AGCTTGGAAATTGCTCTCCTGGG - Intergenic
966889359 3:184395507-184395529 AGCCTTGCCTGTGATCTCCAGGG - Intronic
968520309 4:1032071-1032093 AGCCCTGGATGTGCCCTCCTGGG + Intergenic
969221392 4:5761183-5761205 GGCCTTGGACCTGCTCTCCTCGG - Intronic
971059039 4:22946581-22946603 AGCCTTGAATGTGCTGACACAGG + Intergenic
972749708 4:41976195-41976217 AGGCTGGAACTTGCTCTCCTGGG - Intergenic
978892652 4:113848438-113848460 AGCCTTAAATATGCTCACATTGG - Intergenic
979669836 4:123350644-123350666 AGGCTTGAATGTGATGTCCTTGG - Intergenic
981971193 4:150664090-150664112 AGCCTTGAATGTCATGTCTTAGG + Intronic
984147128 4:176075909-176075931 AGGCTTGAATGTGCTATGATCGG + Intronic
984673037 4:182513980-182514002 AGCCTTTATTGTGGTTTCCTTGG - Intronic
986891352 5:12311508-12311530 AGCCTTGAGTGTTCTATCTTTGG + Intergenic
987249413 5:16082995-16083017 AGCCTGGAATCTGAGCTCCTGGG - Intronic
990543364 5:56797107-56797129 CCCCTTGAATGTGCTCTTCTTGG - Intergenic
991968236 5:72112635-72112657 AGCCCTGAAAGTGAGCTCCTTGG - Intronic
994684995 5:102939176-102939198 AGGCTAGAATGTTCTCTTCTGGG - Intronic
994700831 5:103132613-103132635 AGGCTTGAAAGTGCTTTTCTGGG - Intronic
995273379 5:110248914-110248936 AGCCTTGAATGTTCTCCTCCAGG + Intergenic
996095979 5:119399793-119399815 TGCGTTGAATGTGCTCACCTGGG + Intergenic
999204339 5:149837220-149837242 AGCCTTGAAGGTGGTCTTCTGGG + Intronic
1001017425 5:168153990-168154012 AGCCTGGCCTGTGCTTTCCTGGG - Intronic
1001527412 5:172438495-172438517 AGCCTTGAGTGAGGTCACCTTGG - Intronic
1003308832 6:4951226-4951248 AGCCTTGACTATGAGCTCCTGGG - Intronic
1007280411 6:40708265-40708287 AGGCTGGACTTTGCTCTCCTGGG + Intergenic
1016439460 6:144068278-144068300 TGCCTAGAACCTGCTCTCCTGGG + Intergenic
1017305567 6:152914539-152914561 ATCTTTGAAGCTGCTCTCCTTGG + Intergenic
1021483663 7:21145057-21145079 AGCCTTGCAGGTGGTGTCCTAGG - Intergenic
1021539036 7:21736512-21736534 TGCCTTGAATGTGGGCTCCTGGG + Intronic
1024309026 7:47952276-47952298 AGCCTTGCCCCTGCTCTCCTTGG - Intronic
1024634253 7:51274344-51274366 AATCTTGAATGTGTCCTCCTGGG + Intronic
1028963507 7:96776199-96776221 AGACTTGAATGCTCTCTCTTTGG + Intergenic
1029357471 7:100062927-100062949 AGCCATGATTGTGCTGGCCTGGG - Intronic
1029440084 7:100582615-100582637 CGCCTGGAATGTGCTCCCGTTGG - Intronic
1033861684 7:145635703-145635725 CTGCTTGAATGTGCTCTGCTGGG - Intergenic
1035762916 8:2082752-2082774 AGCATTGGCTGTGCTTTCCTGGG + Intronic
1037112210 8:15177116-15177138 AACTTTGAATTTGCTCTCCCTGG - Intronic
1038269625 8:26064672-26064694 AGCCTCCAATCTCCTCTCCTTGG + Intergenic
1038435743 8:27534820-27534842 AGCCTTGAATGTGCTCTCCTGGG - Intronic
1039452207 8:37684184-37684206 AGGCCTGAATGGGCTCTCCCAGG - Intergenic
1041011652 8:53549608-53549630 AGCCTTAACTGTGCTGTCCTGGG - Intergenic
1043358111 8:79437874-79437896 ATCCTTGAATCTCTTCTCCTAGG - Intergenic
1044470022 8:92556014-92556036 GGCCTAGAATGTCCTCTACTGGG - Intergenic
1045285295 8:100785392-100785414 AGCTTTGCCTGTGATCTCCTGGG - Intergenic
1046814397 8:118568246-118568268 TGCCTTGAATCTTCTTTCCTTGG - Intronic
1047040024 8:120983096-120983118 AGCCTTGGATGTCCTCTGATTGG - Intergenic
1049342188 8:142119037-142119059 AGCCTTCTATGTGGGCTCCTTGG + Intergenic
1050659791 9:7871839-7871861 TGCCTTGGATGAGCTCTTCTCGG + Intronic
1051213779 9:14774675-14774697 ACCCTTGAATCTACTCTCCTTGG - Intronic
1051847927 9:21473853-21473875 AGCCTAAACTGTGCTGTCCTTGG + Intergenic
1051948981 9:22607733-22607755 AGTCTTGAATGTTCTTTCTTTGG - Intergenic
1052797147 9:32933457-32933479 GGCCTTGAATGGGGTCTCCGTGG - Intergenic
1053527081 9:38841199-38841221 TGCTTAGCATGTGCTCTCCTTGG + Intergenic
1054199304 9:62065630-62065652 TGCTTAGCATGTGCTCTCCTTGG + Intergenic
1054639049 9:67522727-67522749 TGCTTAGCATGTGCTCTCCTTGG - Intergenic
1055836558 9:80449589-80449611 AGCCTTTATTGTGGTTTCCTCGG + Intergenic
1056111263 9:83397358-83397380 ATCCTTGAAAGAGCTTTCCTTGG + Intronic
1056253577 9:84775247-84775269 AGAATTGAATCTGCTTTCCTTGG + Intronic
1056786037 9:89593181-89593203 AGCCTGGAATGTGACCTCGTCGG - Intergenic
1057084301 9:92194552-92194574 AGCCTAGAAATTGCACTCCTAGG - Intergenic
1057209126 9:93190080-93190102 AGCACTGAATTTGCTTTCCTGGG + Intronic
1060751599 9:126173421-126173443 AGCCCTGGATCTGCTATCCTTGG + Intergenic
1186705536 X:12136552-12136574 AGCCTGGAATGCTCTTTCCTGGG - Intergenic
1188246849 X:27846362-27846384 GGCCTAGAATGTGGTCTACTTGG + Intergenic
1190099308 X:47508942-47508964 AGGTTTGAATGTGCTCCCCGGGG - Intergenic