ID: 1038435744

View in Genome Browser
Species Human (GRCh38)
Location 8:27534821-27534843
Sequence GAGCCTTGAATGTGCTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038435744_1038435752 26 Left 1038435744 8:27534821-27534843 CCAGGAGAGCACATTCAAGGCTC 0: 1
1: 0
2: 2
3: 12
4: 133
Right 1038435752 8:27534870-27534892 CCCCTTGGTGGTGGGAAAGATGG No data
1038435744_1038435747 11 Left 1038435744 8:27534821-27534843 CCAGGAGAGCACATTCAAGGCTC 0: 1
1: 0
2: 2
3: 12
4: 133
Right 1038435747 8:27534855-27534877 AGAAAAGCAGAGTTACCCCTTGG No data
1038435744_1038435748 14 Left 1038435744 8:27534821-27534843 CCAGGAGAGCACATTCAAGGCTC 0: 1
1: 0
2: 2
3: 12
4: 133
Right 1038435748 8:27534858-27534880 AAAGCAGAGTTACCCCTTGGTGG No data
1038435744_1038435749 17 Left 1038435744 8:27534821-27534843 CCAGGAGAGCACATTCAAGGCTC 0: 1
1: 0
2: 2
3: 12
4: 133
Right 1038435749 8:27534861-27534883 GCAGAGTTACCCCTTGGTGGTGG No data
1038435744_1038435750 18 Left 1038435744 8:27534821-27534843 CCAGGAGAGCACATTCAAGGCTC 0: 1
1: 0
2: 2
3: 12
4: 133
Right 1038435750 8:27534862-27534884 CAGAGTTACCCCTTGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038435744 Original CRISPR GAGCCTTGAATGTGCTCTCC TGG (reversed) Intronic
902401862 1:16162379-16162401 GAGACTTAAATGTGGGCTCCCGG + Intergenic
902830228 1:19007747-19007769 GAACCTTGTTTGTCCTCTCCTGG - Intergenic
911778565 1:101845770-101845792 GTGGCTTGTATGTGCTCTGCTGG + Intronic
915919585 1:159964375-159964397 GAGCTTTTAATCTGTTCTCCTGG + Intergenic
916690424 1:167185020-167185042 GAGCTTGTAATGTGGTCTCCAGG + Intergenic
916848163 1:168674568-168674590 GAGCGTGGAATATGCTCTCTAGG - Intergenic
918410679 1:184255067-184255089 GACCCTTGTATGTGTGCTCCAGG - Intergenic
919868859 1:201804996-201805018 GTGACTTGAGTGTGCCCTCCTGG - Intronic
920118716 1:203639498-203639520 AAGGGTTAAATGTGCTCTCCAGG - Intronic
921887451 1:220321132-220321154 GAGACTTCATTGTGTTCTCCAGG - Intergenic
922930577 1:229386047-229386069 GAGCCTTGATTGTGGTATCTAGG + Intergenic
923114911 1:230926399-230926421 GAGTCTTTAATGAGCTTTCCTGG - Intronic
924593032 1:245421544-245421566 GAGCATTGAATGTTCCCTCTAGG - Intronic
1066081113 10:31931055-31931077 GAGCCTTGAATTTCATTTCCAGG + Intergenic
1074065491 10:110008675-110008697 AAGCCCTGAAGGTGCGCTCCAGG + Intronic
1074820454 10:117174544-117174566 GAGCTGTGACTGTGTTCTCCAGG - Intergenic
1076224556 10:128763765-128763787 GAGCCTTTTCTGAGCTCTCCAGG + Intergenic
1079768798 11:24432018-24432040 GAGCCTTTATTGTGATTTCCAGG + Intergenic
1089858478 11:121567947-121567969 GAGCCGTGAATGTGCCAGCCTGG - Intronic
1090404044 11:126466680-126466702 CAGCCTTGAAGGTACTGTCCAGG + Intronic
1091279148 11:134372146-134372168 GAGCAATGAATGTGATTTCCAGG + Intronic
1101959669 12:109239413-109239435 GAGCCTTGATTGTGGTTTCCTGG + Intronic
1102725548 12:115061185-115061207 GAGGCCTGAATGGGCTCTCCAGG + Intergenic
1102967709 12:117141034-117141056 AAGCCCTGACTCTGCTCTCCGGG - Intergenic
1103887983 12:124217098-124217120 GAGCCTTGATTTGGGTCTCCCGG - Intronic
1104769830 12:131354463-131354485 GAGCCATGGCTCTGCTCTCCTGG + Intergenic
1104891607 12:132142902-132142924 GAGCCTGGAAAGCGCTCACCTGG - Intronic
1106326536 13:28696137-28696159 GAGCCGTGAATGTGCCAGCCTGG - Intergenic
1111993402 13:95138958-95138980 GAGCCTTGAAGGATCTCTCACGG - Intronic
1113104205 13:106755686-106755708 CCTCCTGGAATGTGCTCTCCAGG + Intergenic
1114267147 14:21079533-21079555 GAACCTTGATTCTTCTCTCCTGG + Intronic
1114450361 14:22821593-22821615 TGTCCTTGAATTTGCTCTCCAGG + Intronic
1115948467 14:38693126-38693148 GAATCTTGAATGTGCTATGCTGG - Intergenic
1118593166 14:67416449-67416471 GTGCCTTCAGGGTGCTCTCCTGG - Intergenic
1119221092 14:72908065-72908087 GAGCCCCGCATGTGCTCTGCAGG + Intergenic
1122200036 14:100116989-100117011 CCGCCTTGGCTGTGCTCTCCTGG - Intronic
1125287966 15:38114665-38114687 CTGCCTTAAATTTGCTCTCCTGG + Intergenic
1126778760 15:52120535-52120557 GAACCTGGAATGTGCTTCCCTGG + Exonic
1128588706 15:68875454-68875476 GAGCATTGAATGGGCTCCGCGGG - Intronic
1132390758 15:101436604-101436626 GTGCCCTGATTGTTCTCTCCTGG - Intronic
1133922146 16:10162950-10162972 GAGCCTTGGATGTGCCTTCGTGG - Intronic
1138083627 16:54114932-54114954 GAGGATTTCATGTGCTCTCCAGG + Exonic
1138421697 16:56903255-56903277 GAGTCCTGAAGGTGCTGTCCAGG - Intronic
1139100994 16:63766881-63766903 AAGCCTTGATTGTCCTCACCTGG - Intergenic
1139420924 16:66849105-66849127 TAGGCTTGAATGTGAGCTCCTGG - Intronic
1141622418 16:85243518-85243540 GAGCCTTGCACATGCCCTCCTGG + Intergenic
1142159692 16:88550622-88550644 GAGCCTGGACTGTCCTCTCCCGG - Intergenic
1142201763 16:88764418-88764440 GAAACATGAACGTGCTCTCCAGG + Intronic
1143325020 17:6093041-6093063 GACCCATGAATTTGCTCCCCAGG + Intronic
1143451734 17:7040811-7040833 AACCCTGGAATCTGCTCTCCAGG + Intergenic
1143762458 17:9115363-9115385 CAGCCTTGCATGTGTTCCCCAGG + Intronic
1144164276 17:12593182-12593204 TACCCTTGAATATGCTGTCCTGG + Intergenic
1145298584 17:21613708-21613730 GAGTGTTGGATGTGCTATCCGGG + Intergenic
1145829881 17:27907319-27907341 GAGTCTTGAATCTGCTCTCCTGG - Intergenic
1147544613 17:41391319-41391341 GAGGCTTGAGTCTGCTCTCAGGG - Intronic
1149954562 17:61034141-61034163 AAGCCTTGAAAATGCTCTCTCGG - Intronic
1151669700 17:75565292-75565314 GAGCCCTGCAGGAGCTCTCCAGG + Intronic
1152559373 17:81070373-81070395 GGGTATTGAATGTGCTCTGCCGG + Intronic
1156268716 18:35511895-35511917 GAGAATTGAATGAGCTCTCTAGG - Intergenic
1156396547 18:36704670-36704692 GGGCCTTCACTGTTCTCTCCTGG + Intronic
1157713789 18:49868586-49868608 GAGCCATGACTGTGCTGACCTGG - Intronic
1160579791 18:79877030-79877052 TTGCCTAGAATGTGCTCGCCTGG - Intronic
1163853036 19:19677244-19677266 GAGTCTTTAATGAGCTTTCCTGG - Intronic
1165171078 19:33892009-33892031 GAGCCTGAAATGTGTTCCCCTGG + Intergenic
1165634619 19:37330373-37330395 AACCCTTGAATGTACCCTCCAGG + Intronic
1166944348 19:46387936-46387958 AAGCCTGGAATATGCTCGCCAGG - Intronic
926376084 2:12228965-12228987 GAACCTTGATTCTGCTCTCTGGG + Intergenic
926959245 2:18336220-18336242 GAGTTTAGAATGTGCTCTCCAGG - Intronic
927392816 2:22614280-22614302 GAGAATTGAATGTGATGTCCTGG + Intergenic
927601983 2:24451337-24451359 GAGCCTAGCATGTGCTCATCTGG + Intergenic
931198781 2:60077286-60077308 GGGCCTTGCCTGTGCTCTGCTGG - Intergenic
934165734 2:89292636-89292658 GAGCCTTAAATTTGCTCTTTAGG - Intergenic
934201543 2:89889820-89889842 GAGCCTTAAATTTGCTCTTTAGG + Intergenic
937277509 2:120694797-120694819 GCGCCTTGTATGTGCTCTCCAGG - Intergenic
937364171 2:121248946-121248968 GAGCCTTGCCTGGCCTCTCCTGG + Intronic
937844534 2:126565126-126565148 GAACCTTGGGTGTGCTCTCCTGG + Intergenic
940621484 2:156119203-156119225 GAGACTTGAATGAGATCACCAGG + Intergenic
948490425 2:238309228-238309250 CAGTCCTGGATGTGCTCTCCTGG + Intergenic
1172052779 20:32131905-32131927 TACCCTTGAATGTGATCTCTAGG - Intronic
1172860271 20:38044268-38044290 GAGTCTTTAATGAGCTTTCCTGG - Intronic
1174585142 20:51602582-51602604 GAGCATTTACTGTGCGCTCCAGG - Intronic
1178250070 21:30995231-30995253 AAGCTTTGAATCAGCTCTCCAGG + Intergenic
1179895129 21:44357584-44357606 GAGCCTCGAATGGGCTTTGCAGG - Intronic
1180122844 21:45765485-45765507 GAGCTGCGAATGTGCTCTCCCGG + Intronic
1180191420 21:46165901-46165923 GAGCCTTGAATGGTCTCTGTGGG - Intronic
1180538930 22:16423359-16423381 GAGTGTGGAGTGTGCTCTCCAGG + Intergenic
1184442980 22:44529905-44529927 GAGCTTTAAATGTGCTCTGGTGG - Intergenic
951307586 3:21084557-21084579 GAGCCTTGAATGTGATGACAGGG - Intergenic
952852208 3:37738701-37738723 GACCCATCAATGTGCTCTCTTGG + Intronic
954614265 3:51961483-51961505 GAGGGTTGAATGGGCTCCCCAGG - Intronic
956969546 3:74506705-74506727 GACCATTGACTGTGTTCTCCTGG - Intronic
960404103 3:117238533-117238555 GAGCCTGGAATGTGTGCCCCAGG - Intergenic
961006079 3:123406264-123406286 GAGCCTTTATTGTGGTTTCCAGG - Intronic
961360550 3:126364674-126364696 GAGCCTCCAATGTGGGCTCCAGG + Intergenic
963451569 3:145488564-145488586 GAGGCTTTAAGGTGCTCTGCTGG - Intergenic
964522002 3:157580165-157580187 GAGCCTTGACTGTTCTGGCCTGG - Intronic
966889360 3:184395508-184395530 CAGCCTTGCCTGTGATCTCCAGG - Intronic
967156921 3:186701547-186701569 GAGCCTTGGCTGTGCTCCCAAGG - Intergenic
967243058 3:187460003-187460025 GAGCCAGGAAAGTGCTCTGCAGG + Intergenic
968079751 3:195837699-195837721 GAGCTCTGACTGTGATCTCCAGG - Intergenic
968520308 4:1032070-1032092 CAGCCCTGGATGTGCCCTCCTGG + Intergenic
977991065 4:103442999-103443021 CAGCCTTGAGTATGTTCTCCAGG + Intergenic
980725516 4:136755053-136755075 AAGCCTTGGATGAGCTTTCCTGG - Intergenic
980788210 4:137581964-137581986 GAGTCTTGAAAGTGTTCACCAGG + Intergenic
981180015 4:141730665-141730687 GTACCTAGAATTTGCTCTCCTGG - Intronic
983899749 4:173121226-173121248 GTGCTTTGAATCTGCTCCCCGGG - Intergenic
989792670 5:45424828-45424850 GAGAAATGAATGTGCTTTCCAGG - Intronic
990317232 5:54594648-54594670 GAGTCTTTAATGGGCTCTCTGGG + Intergenic
996095978 5:119399792-119399814 GTGCGTTGAATGTGCTCACCTGG + Intergenic
998129731 5:139645626-139645648 GACCCTGGAGTGTGCTCTCCTGG - Intergenic
999204338 5:149837219-149837241 GAGCCTTGAAGGTGGTCTTCTGG + Intronic
1000957131 5:167556769-167556791 GAGCCTTGCATGTTCTCCCAGGG - Intronic
1002127770 5:177059578-177059600 GAGCATTGAATGTCCCCTCCAGG + Intronic
1007280410 6:40708264-40708286 GAGGCTGGACTTTGCTCTCCTGG + Intergenic
1007494808 6:42252444-42252466 CAGCCCCGAATTTGCTCTCCAGG - Intronic
1016439459 6:144068277-144068299 GTGCCTAGAACCTGCTCTCCTGG + Intergenic
1016772354 6:147865719-147865741 GAGCCTTCAATGTCCACTTCAGG + Intergenic
1019879322 7:3844465-3844487 GGGCCTTGGATGTGCTAGCCTGG + Intronic
1020280481 7:6647691-6647713 GAGTCTGGAACCTGCTCTCCAGG - Intronic
1021539035 7:21736511-21736533 TTGCCTTGAATGTGGGCTCCTGG + Intronic
1022888448 7:34671510-34671532 GATCCTTTAATGTGCTCTCTGGG - Intronic
1025998583 7:66543994-66544016 GATGCTTGAATGGGCTCTCAAGG - Intergenic
1026991541 7:74588830-74588852 GATGCTTGAATGGGCTCTCAAGG - Intronic
1029357472 7:100062928-100062950 GAGCCATGATTGTGCTGGCCTGG - Intronic
1033321702 7:140345752-140345774 GGGCCTTGAAGCTGGTCTCCAGG + Intronic
1035603960 8:916909-916931 GAGCCCTGGGTGTGCCCTCCCGG - Intergenic
1038435744 8:27534821-27534843 GAGCCTTGAATGTGCTCTCCTGG - Intronic
1041011653 8:53549609-53549631 AAGCCTTAACTGTGCTGTCCTGG - Intergenic
1041806184 8:61851766-61851788 GCACCTTGAATCTACTCTCCCGG + Intergenic
1043252207 8:78088837-78088859 GAGCCATGAATGTGGACTACTGG + Intergenic
1048287518 8:133153368-133153390 GAACCTTGAAGGCACTCTCCAGG - Intergenic
1052175588 9:25458782-25458804 AAGGCTTGAATGTTCTATCCTGG - Intergenic
1052244203 9:26313971-26313993 GAGTCTTTAATGAGCTTTCCTGG + Intergenic
1057342162 9:94212617-94212639 GAGCCATCAGTGAGCTCTCCAGG + Intergenic
1059057931 9:111004042-111004064 GAGCCTTGATTATGCCCTCATGG - Intronic
1062514821 9:136927512-136927534 GAGACTGGAAGGTGCTCTCTAGG - Intronic
1186051012 X:5595653-5595675 GAGCTTTTCATGTGCTGTCCAGG + Intergenic
1186443394 X:9605059-9605081 GACCCTGGAATGTCATCTCCTGG + Intronic
1189175404 X:38952085-38952107 CAGCATTGGTTGTGCTCTCCTGG - Intergenic
1190099309 X:47508943-47508965 GAGGTTTGAATGTGCTCCCCGGG - Intergenic
1190894493 X:54603758-54603780 GAAACTTGAATGTACTCTCTGGG + Intergenic
1192317285 X:70062848-70062870 CAGCCTGGAAGATGCTCTCCTGG - Exonic
1195565021 X:106330569-106330591 GAACCCTGAATTTGCTGTCCAGG - Intergenic
1197772860 X:130100493-130100515 GAGCCTGGAATGTTCCCTCAGGG - Intronic
1198791129 X:140347608-140347630 CAGCCTTGAGTGTGCCTTCCAGG + Intergenic
1200919994 Y:8604758-8604780 GGGCCTTGCAGGTGCTCTCTTGG - Intergenic
1201222087 Y:11781743-11781765 GAGCCCTGAATATGGTCACCTGG - Intergenic
1202017281 Y:20423231-20423253 GGGCCTTTGATGTGCTGTCCTGG + Intergenic