ID: 1038435750

View in Genome Browser
Species Human (GRCh38)
Location 8:27534862-27534884
Sequence CAGAGTTACCCCTTGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038435743_1038435750 19 Left 1038435743 8:27534820-27534842 CCCAGGAGAGCACATTCAAGGCT 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1038435750 8:27534862-27534884 CAGAGTTACCCCTTGGTGGTGGG No data
1038435744_1038435750 18 Left 1038435744 8:27534821-27534843 CCAGGAGAGCACATTCAAGGCTC 0: 1
1: 0
2: 2
3: 12
4: 133
Right 1038435750 8:27534862-27534884 CAGAGTTACCCCTTGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038435750 Original CRISPR CAGAGTTACCCCTTGGTGGT GGG Intronic
No off target data available for this crispr