ID: 1038436245

View in Genome Browser
Species Human (GRCh38)
Location 8:27538824-27538846
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038436245_1038436250 6 Left 1038436245 8:27538824-27538846 CCTCGGCATGCATAGGGCTGACT 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1038436250 8:27538853-27538875 CCAGGCCTGAGCACACAGCCTGG 0: 1
1: 0
2: 10
3: 78
4: 586
1038436245_1038436254 24 Left 1038436245 8:27538824-27538846 CCTCGGCATGCATAGGGCTGACT 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1038436254 8:27538871-27538893 CCTGGAGTTCCTACCCTCTAGGG 0: 1
1: 0
2: 0
3: 10
4: 147
1038436245_1038436252 23 Left 1038436245 8:27538824-27538846 CCTCGGCATGCATAGGGCTGACT 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1038436252 8:27538870-27538892 GCCTGGAGTTCCTACCCTCTAGG 0: 1
1: 0
2: 2
3: 17
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038436245 Original CRISPR AGTCAGCCCTATGCATGCCG AGG (reversed) Intronic