ID: 1038436245

View in Genome Browser
Species Human (GRCh38)
Location 8:27538824-27538846
Sequence AGTCAGCCCTATGCATGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038436245_1038436252 23 Left 1038436245 8:27538824-27538846 CCTCGGCATGCATAGGGCTGACT 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1038436252 8:27538870-27538892 GCCTGGAGTTCCTACCCTCTAGG 0: 1
1: 0
2: 2
3: 17
4: 360
1038436245_1038436254 24 Left 1038436245 8:27538824-27538846 CCTCGGCATGCATAGGGCTGACT 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1038436254 8:27538871-27538893 CCTGGAGTTCCTACCCTCTAGGG 0: 1
1: 0
2: 0
3: 10
4: 147
1038436245_1038436250 6 Left 1038436245 8:27538824-27538846 CCTCGGCATGCATAGGGCTGACT 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1038436250 8:27538853-27538875 CCAGGCCTGAGCACACAGCCTGG 0: 1
1: 0
2: 10
3: 78
4: 586

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038436245 Original CRISPR AGTCAGCCCTATGCATGCCG AGG (reversed) Intronic
900787657 1:4658823-4658845 AGACAGCCCCACGCCTGCCGGGG + Intronic
901822569 1:11839588-11839610 AGTACGCACTATGCATGCCAGGG - Intronic
901847929 1:11996338-11996360 TGTCAGCCCTGTGCCTGCTGGGG + Intronic
904705849 1:32390130-32390152 GGTCAGCCCTATGGATGATGGGG + Intronic
904862583 1:33549945-33549967 AGTCAGCCCTGACCATGCCCAGG - Intronic
905938671 1:41845033-41845055 AGTGAGCCCTGTGGATGCCCAGG - Intronic
910090149 1:83452338-83452360 AGTCAGCCCTCTGTATCCCTTGG - Intergenic
910606158 1:89087251-89087273 AGCCAGCCCTATGCAAACAGGGG + Intergenic
910737206 1:90472999-90473021 AGGCAGCCATCTGCATGCCAAGG - Intergenic
914462111 1:147894648-147894670 AGTCTGCCCTATGAAACCCGTGG - Intergenic
920861564 1:209712287-209712309 AGCCAGCACTCTGCATGCCTGGG + Intronic
1063388467 10:5632242-5632264 AGTGATACCTCTGCATGCCGGGG - Intergenic
1063861249 10:10310128-10310150 AGTAAGCCCTATTCATACCATGG + Intergenic
1070996597 10:80789027-80789049 AGTCAGCCCTCTGTATACAGGGG - Intergenic
1073856866 10:107686260-107686282 AGTCAGCCATCTGCAAGCCAGGG - Intergenic
1074586634 10:114774299-114774321 AGTGAGTCCTATGAATGCCATGG + Intergenic
1076310456 10:129502639-129502661 AGTCACCCCTCTTCATGCAGGGG - Intronic
1079077382 11:17392598-17392620 AGGCAGCCCTCTGCAAGCCAAGG + Intergenic
1079483125 11:20904590-20904612 AGAAAGCCATATGCATGCCTAGG + Intronic
1082607614 11:55261062-55261084 TGTCAGCCCTATGTCTGTCGAGG - Intergenic
1082641522 11:55666906-55666928 AGTCAGCCCTCTGCATCCACGGG + Intergenic
1082781066 11:57287747-57287769 AGTCAGCCATCTGCAAGCCAAGG + Intergenic
1085537230 11:77229414-77229436 AGTCACCCTTATACATGCAGGGG + Intronic
1085670593 11:78460793-78460815 AGTCAGCCCTCTGTATTCAGAGG + Intronic
1089559600 11:119337176-119337198 AGTCTGCCCTCTCCATGCCAGGG - Exonic
1090985923 11:131766064-131766086 AGTCAGCCCCCTCCATGCCCAGG - Intronic
1093486320 12:19656766-19656788 AGGCAGCCATTTGCAAGCCGAGG - Intronic
1100344441 12:93713703-93713725 AGTCAGCCCTCTGTATCCCCAGG - Intronic
1111423309 13:88046579-88046601 AGTCAGCCCTATGGCTGCCTGGG + Intergenic
1116968177 14:51036726-51036748 AGTCAGCCCTCTGTATGCATGGG - Intronic
1118470764 14:66073373-66073395 AGGCAGCCCTCTGCTTGCTGGGG + Intergenic
1118607885 14:67516331-67516353 CGCAAACCCTATGCATGCCGAGG + Intronic
1121331692 14:93053613-93053635 AGTGAGCCCTATGCACACTGGGG + Intronic
1121816133 14:96930091-96930113 CCTCAGCCCCATGCATCCCGAGG + Intronic
1127491826 15:59472279-59472301 AGTGAGCCGTAGTCATGCCGGGG + Intronic
1127982528 15:64045667-64045689 AGCCAGACCTATGCAAGCCTTGG + Intronic
1129408350 15:75334791-75334813 AGTCAGCCCTCTGTATCCTGAGG + Intergenic
1129654888 15:77517393-77517415 AGTCAACCCTTTGCATGACATGG + Intergenic
1130386558 15:83417115-83417137 AGGCAGCCCTCTGCAAGCCACGG - Intergenic
1147376934 17:40027883-40027905 AGTCAGCCCTGTGCATCCGCAGG - Intronic
1150990119 17:70247791-70247813 AGTCAGCCCTGTGGAAGCTGTGG + Intergenic
1153840310 18:9001443-9001465 AGGCAGCCCTCTGCAAGCCAAGG + Intergenic
1154167555 18:12027368-12027390 AGTGAGCCCTCTGGATGCAGGGG - Intronic
1157790419 18:50526190-50526212 AGTCAGCCCTAAGAATACCATGG + Intergenic
1157818188 18:50746221-50746243 AGTCCGCCTTGTGCATGCAGAGG + Intergenic
1159136541 18:64343440-64343462 AGACAGCCATATGCAAGCCAAGG - Intergenic
1162458924 19:10802931-10802953 AGTGAGGCCTAAGCATGCCAAGG - Intronic
1165864138 19:38925747-38925769 AATCAGCCCTAGGGATGCCAGGG + Intronic
937728748 2:125199803-125199825 ACTCAGCCCTTTCCATGCCAAGG - Intergenic
941659581 2:168182044-168182066 AGGCAGCCCTATGCAAACCCAGG - Exonic
943886557 2:193225435-193225457 AGTCAGCTATATGCAAGCTGAGG + Intergenic
946889032 2:224255260-224255282 ATTCAGCCCAATGCATTCAGTGG + Intergenic
948734981 2:239997131-239997153 AGTCAGCCCTTTGTATCCCTGGG - Intronic
1170882680 20:20310971-20310993 AGACAGCCCTGTGCAGGACGTGG - Intronic
1172986018 20:38990505-38990527 AGTCAGTCCTCTGCATCCTGCGG + Intronic
1173892061 20:46520415-46520437 AGTCAGGCCTATGAATGACATGG + Intergenic
1174724024 20:52842519-52842541 AGTCAGCCCTCTACATGCCTGGG - Intergenic
1175968547 20:62672370-62672392 AGTCAGCCCTGTGGAATCCGTGG + Intronic
1177048224 21:16198781-16198803 AAGCAGCTCTATGCAAGCCGTGG + Intergenic
1177453229 21:21300112-21300134 AGTCAGCCCTCTGTATCCCCAGG - Intronic
1177605616 21:23374395-23374417 AGTCTGCCCTCTGCAAGCCAAGG + Intergenic
1177907960 21:26994828-26994850 AGTCAGCCCTGTGGAACCCGTGG + Intergenic
1180352974 22:11819091-11819113 AGTCAGCCCCATGCACCCAGGGG + Intergenic
1180385270 22:12173266-12173288 AGTCAGCCCCATGCACCCAGGGG - Intergenic
1182115936 22:27756403-27756425 AGGCAGCCCTTTGCCTGGCGTGG - Intronic
951296451 3:20942018-20942040 AGTCAGCCATGTGCAAGCCAAGG + Intergenic
951812716 3:26718458-26718480 AGTCAGCCATCTGCAAGCCAAGG + Intergenic
953273936 3:41476110-41476132 TGTCAGCCCTATGCAAACCCAGG - Intronic
957535014 3:81490984-81491006 AGTCAGGGCTTTGCATGCCATGG - Intronic
958790669 3:98647391-98647413 AGGCAGCCCTCTGCAAGCCAAGG - Intergenic
961158630 3:124702950-124702972 ATTCATCCCTATGCATGCTTTGG + Intronic
961509633 3:127392919-127392941 AGTCAGCCCCAGCCATGCCCAGG - Intergenic
970257540 4:14184244-14184266 AGTCTGCCTTATCCATGCCTTGG - Intergenic
974691619 4:65304622-65304644 AAACAGCCCTCTGCATGCCAGGG + Intergenic
976163085 4:82224443-82224465 AGTCTGCCCTATGCATGATTTGG - Intergenic
977777947 4:100944544-100944566 AGTCAGCCCTCTGTATACAGAGG - Intergenic
985998788 5:3613815-3613837 TGGCAGCCCTCTGCATGCCACGG - Intergenic
986301538 5:6481896-6481918 TGTCAGCTTTATGCCTGCCGTGG + Intronic
986725641 5:10594562-10594584 ACTCATCCCCATGCATGCCGAGG + Intronic
986793340 5:11185015-11185037 AGTCATCCGTGTGCATGCAGGGG - Intronic
996972083 5:129383410-129383432 AGTCATCCCTCTGTATGCTGGGG + Intergenic
1005582738 6:27249848-27249870 ACTCATCCCTCTGCATGGCGTGG + Intronic
1007113957 6:39330241-39330263 GGTCAACCCTATGCATGCACTGG + Exonic
1011618650 6:89221383-89221405 AGTCAGCCCTCTGCATCCGTGGG + Intronic
1014988854 6:128048636-128048658 AGTCAGCCCTCTGCATTCATGGG + Intronic
1016653690 6:146493317-146493339 AGTCAGTCATGTGCAAGCCGGGG - Intergenic
1018742910 6:166744228-166744250 AGCCAGCCCTGTGGATGCAGTGG + Intronic
1027306998 7:76908784-76908806 AGTCAGCCCTCTGTATCCCTTGG - Intergenic
1031746033 7:125499264-125499286 AGACAGCCATATGCAAGCCAAGG + Intergenic
1034288547 7:149908159-149908181 AGGCAGCCCTCTGCAGGCCGTGG + Intergenic
1034662526 7:152784708-152784730 AGGCAGCCCTCTGCAGGCCGTGG - Intronic
1038436245 8:27538824-27538846 AGTCAGCCCTATGCATGCCGAGG - Intronic
1040096722 8:43452291-43452313 AGTCAGTCCAATGCATGCATGGG + Intergenic
1044840560 8:96333370-96333392 AGACCGCCCTAGGCTTGCCGGGG - Intronic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1051002979 9:12307644-12307666 AGGCAGCCCTTTCCATGCCTCGG - Intergenic
1061295568 9:129675105-129675127 AGCCAGCCTTATGCATCCTGCGG - Intronic
1061909683 9:133716088-133716110 AGTCAGCGCTGGGCCTGCCGCGG - Intronic
1197012653 X:121585886-121585908 AGTCAGCCCTCTGTATCCAGGGG + Intergenic
1199009672 X:142744154-142744176 AGGCAGCCATTTGCAAGCCGAGG - Intergenic
1199419144 X:147622864-147622886 AGTCAGCCCTCTGTATGCATGGG - Intergenic