ID: 1038439659

View in Genome Browser
Species Human (GRCh38)
Location 8:27562549-27562571
Sequence CTTGCCTAACAGCTGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038439659_1038439662 -7 Left 1038439659 8:27562549-27562571 CCTTGCACCAGCTGTTAGGCAAG No data
Right 1038439662 8:27562565-27562587 AGGCAAGTGCCTTGTGCCTCGGG No data
1038439659_1038439667 21 Left 1038439659 8:27562549-27562571 CCTTGCACCAGCTGTTAGGCAAG No data
Right 1038439667 8:27562593-27562615 AGCATCCTGCCTTAGAAAACAGG No data
1038439659_1038439663 -6 Left 1038439659 8:27562549-27562571 CCTTGCACCAGCTGTTAGGCAAG No data
Right 1038439663 8:27562566-27562588 GGCAAGTGCCTTGTGCCTCGGGG No data
1038439659_1038439661 -8 Left 1038439659 8:27562549-27562571 CCTTGCACCAGCTGTTAGGCAAG No data
Right 1038439661 8:27562564-27562586 TAGGCAAGTGCCTTGTGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038439659 Original CRISPR CTTGCCTAACAGCTGGTGCA AGG (reversed) Intergenic
No off target data available for this crispr