ID: 1038441401

View in Genome Browser
Species Human (GRCh38)
Location 8:27573140-27573162
Sequence GAATAATCAGCTCCGGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038441401_1038441407 14 Left 1038441401 8:27573140-27573162 CCCACACCCGGAGCTGATTATTC No data
Right 1038441407 8:27573177-27573199 CCTCTCTCTGTGAGAACAGCTGG No data
1038441401_1038441408 19 Left 1038441401 8:27573140-27573162 CCCACACCCGGAGCTGATTATTC No data
Right 1038441408 8:27573182-27573204 CTCTGTGAGAACAGCTGGAGTGG No data
1038441401_1038441411 27 Left 1038441401 8:27573140-27573162 CCCACACCCGGAGCTGATTATTC No data
Right 1038441411 8:27573190-27573212 GAACAGCTGGAGTGGGGCATTGG No data
1038441401_1038441412 28 Left 1038441401 8:27573140-27573162 CCCACACCCGGAGCTGATTATTC No data
Right 1038441412 8:27573191-27573213 AACAGCTGGAGTGGGGCATTGGG No data
1038441401_1038441410 21 Left 1038441401 8:27573140-27573162 CCCACACCCGGAGCTGATTATTC No data
Right 1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG No data
1038441401_1038441409 20 Left 1038441401 8:27573140-27573162 CCCACACCCGGAGCTGATTATTC No data
Right 1038441409 8:27573183-27573205 TCTGTGAGAACAGCTGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038441401 Original CRISPR GAATAATCAGCTCCGGGTGT GGG (reversed) Intergenic
No off target data available for this crispr