ID: 1038441402

View in Genome Browser
Species Human (GRCh38)
Location 8:27573141-27573163
Sequence TGAATAATCAGCTCCGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038441402_1038441412 27 Left 1038441402 8:27573141-27573163 CCACACCCGGAGCTGATTATTCA No data
Right 1038441412 8:27573191-27573213 AACAGCTGGAGTGGGGCATTGGG No data
1038441402_1038441409 19 Left 1038441402 8:27573141-27573163 CCACACCCGGAGCTGATTATTCA No data
Right 1038441409 8:27573183-27573205 TCTGTGAGAACAGCTGGAGTGGG No data
1038441402_1038441411 26 Left 1038441402 8:27573141-27573163 CCACACCCGGAGCTGATTATTCA No data
Right 1038441411 8:27573190-27573212 GAACAGCTGGAGTGGGGCATTGG No data
1038441402_1038441407 13 Left 1038441402 8:27573141-27573163 CCACACCCGGAGCTGATTATTCA No data
Right 1038441407 8:27573177-27573199 CCTCTCTCTGTGAGAACAGCTGG No data
1038441402_1038441408 18 Left 1038441402 8:27573141-27573163 CCACACCCGGAGCTGATTATTCA No data
Right 1038441408 8:27573182-27573204 CTCTGTGAGAACAGCTGGAGTGG No data
1038441402_1038441410 20 Left 1038441402 8:27573141-27573163 CCACACCCGGAGCTGATTATTCA No data
Right 1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038441402 Original CRISPR TGAATAATCAGCTCCGGGTG TGG (reversed) Intergenic
No off target data available for this crispr