ID: 1038441404

View in Genome Browser
Species Human (GRCh38)
Location 8:27573147-27573169
Sequence TGGCTGTGAATAATCAGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038441404_1038441407 7 Left 1038441404 8:27573147-27573169 CCGGAGCTGATTATTCACAGCCA No data
Right 1038441407 8:27573177-27573199 CCTCTCTCTGTGAGAACAGCTGG No data
1038441404_1038441412 21 Left 1038441404 8:27573147-27573169 CCGGAGCTGATTATTCACAGCCA No data
Right 1038441412 8:27573191-27573213 AACAGCTGGAGTGGGGCATTGGG No data
1038441404_1038441411 20 Left 1038441404 8:27573147-27573169 CCGGAGCTGATTATTCACAGCCA No data
Right 1038441411 8:27573190-27573212 GAACAGCTGGAGTGGGGCATTGG No data
1038441404_1038441414 26 Left 1038441404 8:27573147-27573169 CCGGAGCTGATTATTCACAGCCA No data
Right 1038441414 8:27573196-27573218 CTGGAGTGGGGCATTGGGCAGGG No data
1038441404_1038441410 14 Left 1038441404 8:27573147-27573169 CCGGAGCTGATTATTCACAGCCA No data
Right 1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG No data
1038441404_1038441408 12 Left 1038441404 8:27573147-27573169 CCGGAGCTGATTATTCACAGCCA No data
Right 1038441408 8:27573182-27573204 CTCTGTGAGAACAGCTGGAGTGG No data
1038441404_1038441409 13 Left 1038441404 8:27573147-27573169 CCGGAGCTGATTATTCACAGCCA No data
Right 1038441409 8:27573183-27573205 TCTGTGAGAACAGCTGGAGTGGG No data
1038441404_1038441413 25 Left 1038441404 8:27573147-27573169 CCGGAGCTGATTATTCACAGCCA No data
Right 1038441413 8:27573195-27573217 GCTGGAGTGGGGCATTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038441404 Original CRISPR TGGCTGTGAATAATCAGCTC CGG (reversed) Intergenic
No off target data available for this crispr