ID: 1038441405

View in Genome Browser
Species Human (GRCh38)
Location 8:27573167-27573189
Sequence TCACAGAGAGAGGTCAGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038441405_1038441416 12 Left 1038441405 8:27573167-27573189 CCATTGCTGACCTCTCTCTGTGA No data
Right 1038441416 8:27573202-27573224 TGGGGCATTGGGCAGGGTGAGGG No data
1038441405_1038441411 0 Left 1038441405 8:27573167-27573189 CCATTGCTGACCTCTCTCTGTGA No data
Right 1038441411 8:27573190-27573212 GAACAGCTGGAGTGGGGCATTGG No data
1038441405_1038441409 -7 Left 1038441405 8:27573167-27573189 CCATTGCTGACCTCTCTCTGTGA No data
Right 1038441409 8:27573183-27573205 TCTGTGAGAACAGCTGGAGTGGG No data
1038441405_1038441408 -8 Left 1038441405 8:27573167-27573189 CCATTGCTGACCTCTCTCTGTGA No data
Right 1038441408 8:27573182-27573204 CTCTGTGAGAACAGCTGGAGTGG No data
1038441405_1038441415 11 Left 1038441405 8:27573167-27573189 CCATTGCTGACCTCTCTCTGTGA No data
Right 1038441415 8:27573201-27573223 GTGGGGCATTGGGCAGGGTGAGG No data
1038441405_1038441414 6 Left 1038441405 8:27573167-27573189 CCATTGCTGACCTCTCTCTGTGA No data
Right 1038441414 8:27573196-27573218 CTGGAGTGGGGCATTGGGCAGGG No data
1038441405_1038441410 -6 Left 1038441405 8:27573167-27573189 CCATTGCTGACCTCTCTCTGTGA No data
Right 1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG No data
1038441405_1038441417 13 Left 1038441405 8:27573167-27573189 CCATTGCTGACCTCTCTCTGTGA No data
Right 1038441417 8:27573203-27573225 GGGGCATTGGGCAGGGTGAGGGG No data
1038441405_1038441413 5 Left 1038441405 8:27573167-27573189 CCATTGCTGACCTCTCTCTGTGA No data
Right 1038441413 8:27573195-27573217 GCTGGAGTGGGGCATTGGGCAGG No data
1038441405_1038441412 1 Left 1038441405 8:27573167-27573189 CCATTGCTGACCTCTCTCTGTGA No data
Right 1038441412 8:27573191-27573213 AACAGCTGGAGTGGGGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038441405 Original CRISPR TCACAGAGAGAGGTCAGCAA TGG (reversed) Intergenic
No off target data available for this crispr