ID: 1038441406

View in Genome Browser
Species Human (GRCh38)
Location 8:27573177-27573199
Sequence CCAGCTGTTCTCACAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038441406_1038441413 -5 Left 1038441406 8:27573177-27573199 CCTCTCTCTGTGAGAACAGCTGG No data
Right 1038441413 8:27573195-27573217 GCTGGAGTGGGGCATTGGGCAGG No data
1038441406_1038441417 3 Left 1038441406 8:27573177-27573199 CCTCTCTCTGTGAGAACAGCTGG No data
Right 1038441417 8:27573203-27573225 GGGGCATTGGGCAGGGTGAGGGG No data
1038441406_1038441414 -4 Left 1038441406 8:27573177-27573199 CCTCTCTCTGTGAGAACAGCTGG No data
Right 1038441414 8:27573196-27573218 CTGGAGTGGGGCATTGGGCAGGG No data
1038441406_1038441415 1 Left 1038441406 8:27573177-27573199 CCTCTCTCTGTGAGAACAGCTGG No data
Right 1038441415 8:27573201-27573223 GTGGGGCATTGGGCAGGGTGAGG No data
1038441406_1038441412 -9 Left 1038441406 8:27573177-27573199 CCTCTCTCTGTGAGAACAGCTGG No data
Right 1038441412 8:27573191-27573213 AACAGCTGGAGTGGGGCATTGGG No data
1038441406_1038441411 -10 Left 1038441406 8:27573177-27573199 CCTCTCTCTGTGAGAACAGCTGG No data
Right 1038441411 8:27573190-27573212 GAACAGCTGGAGTGGGGCATTGG No data
1038441406_1038441418 25 Left 1038441406 8:27573177-27573199 CCTCTCTCTGTGAGAACAGCTGG No data
Right 1038441418 8:27573225-27573247 GTGAATGACCATCACAAGCCAGG No data
1038441406_1038441416 2 Left 1038441406 8:27573177-27573199 CCTCTCTCTGTGAGAACAGCTGG No data
Right 1038441416 8:27573202-27573224 TGGGGCATTGGGCAGGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038441406 Original CRISPR CCAGCTGTTCTCACAGAGAG AGG (reversed) Intergenic
No off target data available for this crispr