ID: 1038441410

View in Genome Browser
Species Human (GRCh38)
Location 8:27573184-27573206
Sequence CTGTGAGAACAGCTGGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038441402_1038441410 20 Left 1038441402 8:27573141-27573163 CCACACCCGGAGCTGATTATTCA No data
Right 1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG No data
1038441403_1038441410 15 Left 1038441403 8:27573146-27573168 CCCGGAGCTGATTATTCACAGCC No data
Right 1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG No data
1038441401_1038441410 21 Left 1038441401 8:27573140-27573162 CCCACACCCGGAGCTGATTATTC No data
Right 1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG No data
1038441405_1038441410 -6 Left 1038441405 8:27573167-27573189 CCATTGCTGACCTCTCTCTGTGA No data
Right 1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG No data
1038441404_1038441410 14 Left 1038441404 8:27573147-27573169 CCGGAGCTGATTATTCACAGCCA No data
Right 1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038441410 Original CRISPR CTGTGAGAACAGCTGGAGTG GGG Intergenic
No off target data available for this crispr