ID: 1038441413

View in Genome Browser
Species Human (GRCh38)
Location 8:27573195-27573217
Sequence GCTGGAGTGGGGCATTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038441405_1038441413 5 Left 1038441405 8:27573167-27573189 CCATTGCTGACCTCTCTCTGTGA No data
Right 1038441413 8:27573195-27573217 GCTGGAGTGGGGCATTGGGCAGG No data
1038441403_1038441413 26 Left 1038441403 8:27573146-27573168 CCCGGAGCTGATTATTCACAGCC No data
Right 1038441413 8:27573195-27573217 GCTGGAGTGGGGCATTGGGCAGG No data
1038441404_1038441413 25 Left 1038441404 8:27573147-27573169 CCGGAGCTGATTATTCACAGCCA No data
Right 1038441413 8:27573195-27573217 GCTGGAGTGGGGCATTGGGCAGG No data
1038441406_1038441413 -5 Left 1038441406 8:27573177-27573199 CCTCTCTCTGTGAGAACAGCTGG No data
Right 1038441413 8:27573195-27573217 GCTGGAGTGGGGCATTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038441413 Original CRISPR GCTGGAGTGGGGCATTGGGC AGG Intergenic
No off target data available for this crispr