ID: 1038441417

View in Genome Browser
Species Human (GRCh38)
Location 8:27573203-27573225
Sequence GGGGCATTGGGCAGGGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038441406_1038441417 3 Left 1038441406 8:27573177-27573199 CCTCTCTCTGTGAGAACAGCTGG No data
Right 1038441417 8:27573203-27573225 GGGGCATTGGGCAGGGTGAGGGG No data
1038441405_1038441417 13 Left 1038441405 8:27573167-27573189 CCATTGCTGACCTCTCTCTGTGA No data
Right 1038441417 8:27573203-27573225 GGGGCATTGGGCAGGGTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038441417 Original CRISPR GGGGCATTGGGCAGGGTGAG GGG Intergenic
No off target data available for this crispr