ID: 1038441891

View in Genome Browser
Species Human (GRCh38)
Location 8:27576419-27576441
Sequence CTTAGTAACCACTTGGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038441884_1038441891 14 Left 1038441884 8:27576382-27576404 CCCGATGAGAGGGTGTTGAATTC No data
Right 1038441891 8:27576419-27576441 CTTAGTAACCACTTGGTGCTAGG No data
1038441883_1038441891 15 Left 1038441883 8:27576381-27576403 CCCCGATGAGAGGGTGTTGAATT No data
Right 1038441891 8:27576419-27576441 CTTAGTAACCACTTGGTGCTAGG No data
1038441885_1038441891 13 Left 1038441885 8:27576383-27576405 CCGATGAGAGGGTGTTGAATTCA No data
Right 1038441891 8:27576419-27576441 CTTAGTAACCACTTGGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038441891 Original CRISPR CTTAGTAACCACTTGGTGCT AGG Intergenic
No off target data available for this crispr