ID: 1038447850

View in Genome Browser
Species Human (GRCh38)
Location 8:27616047-27616069
Sequence AGGGCAAAGTGATTAGTCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038447850_1038447855 1 Left 1038447850 8:27616047-27616069 CCTCGGACTAATCACTTTGCCCT No data
Right 1038447855 8:27616071-27616093 GGGCCTCAGTTTCTTCCATCTGG No data
1038447850_1038447857 10 Left 1038447850 8:27616047-27616069 CCTCGGACTAATCACTTTGCCCT No data
Right 1038447857 8:27616080-27616102 TTTCTTCCATCTGGACGATGAGG No data
1038447850_1038447861 22 Left 1038447850 8:27616047-27616069 CCTCGGACTAATCACTTTGCCCT No data
Right 1038447861 8:27616092-27616114 GGACGATGAGGAATCGGGAATGG No data
1038447850_1038447860 17 Left 1038447850 8:27616047-27616069 CCTCGGACTAATCACTTTGCCCT No data
Right 1038447860 8:27616087-27616109 CATCTGGACGATGAGGAATCGGG No data
1038447850_1038447859 16 Left 1038447850 8:27616047-27616069 CCTCGGACTAATCACTTTGCCCT No data
Right 1038447859 8:27616086-27616108 CCATCTGGACGATGAGGAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038447850 Original CRISPR AGGGCAAAGTGATTAGTCCG AGG (reversed) Intergenic
No off target data available for this crispr